Incidental Mutation 'R5025:Eef1akmt2'
ID453248
Institutional Source Beutler Lab
Gene Symbol Eef1akmt2
Ensembl Gene ENSMUSG00000030960
Gene NameEEF1A lysine methyltransferase 2
SynonymsMettl10, 2010208K18Rik
MMRRC Submission 042616-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5025 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location132827457-132852673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 132851489 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 38 (W38L)
Ref Sequence ENSEMBL: ENSMUSP00000140096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033257] [ENSMUST00000120425] [ENSMUST00000124096] [ENSMUST00000152410]
Predicted Effect probably damaging
Transcript: ENSMUST00000033257
AA Change: W38L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033257
Gene: ENSMUSG00000030960
AA Change: W38L

DomainStartEndE-ValueType
Pfam:Methyltransf_23 42 183 2.8e-9 PFAM
Pfam:PrmA 64 159 8.6e-7 PFAM
Pfam:Methyltransf_31 79 234 1.1e-16 PFAM
Pfam:Methyltransf_18 80 192 7.1e-16 PFAM
Pfam:Methyltransf_11 84 189 2.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120425
AA Change: W38L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113039
Gene: ENSMUSG00000030960
AA Change: W38L

DomainStartEndE-ValueType
SCOP:d1f3la_ 36 96 8e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135932
Predicted Effect unknown
Transcript: ENSMUST00000141920
AA Change: W30L
Predicted Effect probably damaging
Transcript: ENSMUST00000152410
AA Change: W38L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140096
Gene: ENSMUSG00000030960
AA Change: W38L

DomainStartEndE-ValueType
SCOP:d1jsxa_ 36 97 8e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154914
Meta Mutation Damage Score 0.504 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,554,496 F10I unknown Het
Adad1 G T 3: 37,065,210 A147S probably damaging Het
Atg14 T G 14: 47,545,816 N354T probably damaging Het
Brip1 T A 11: 86,064,980 E902D probably benign Het
Brwd1 A G 16: 96,053,972 S419P probably damaging Het
Camsap3 A G 8: 3,604,244 K638R probably damaging Het
Dennd4c T A 4: 86,795,299 probably null Het
Dnah3 T C 7: 120,071,905 N585S probably benign Het
Fasn A T 11: 120,811,908 D1709E probably benign Het
Fbrsl1 T C 5: 110,417,901 D179G probably damaging Het
Fbxl18 A T 5: 142,886,313 I389N probably damaging Het
Fuca1 G T 4: 135,932,926 G252C probably damaging Het
Fut9 T A 4: 25,620,502 H104L probably damaging Het
Glra1 C T 11: 55,536,505 probably null Het
Gpsm1 T C 2: 26,319,996 V45A possibly damaging Het
Hadha A G 5: 30,154,961 probably benign Het
Hddc2 C T 10: 31,327,953 T192I probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Igkv14-100 A G 6: 68,519,399 D92G probably damaging Het
Il17rc T C 6: 113,472,366 V88A possibly damaging Het
Inpp5j T C 11: 3,500,664 D563G probably damaging Het
Lamc3 T A 2: 31,908,669 N462K probably benign Het
Mrpl15 T C 1: 4,784,145 probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Olfr135 T C 17: 38,208,443 L66P probably damaging Het
Olfr1484 G T 19: 13,585,522 A30S probably benign Het
Psg20 T C 7: 18,674,366 *473W probably null Het
Rimbp3 A G 16: 17,209,807 E365G probably damaging Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Snai2 A G 16: 14,708,189 T235A possibly damaging Het
Tg A T 15: 66,707,930 Y1528F probably damaging Het
Tlr3 A G 8: 45,403,038 V35A probably benign Het
Tnfsf15 T C 4: 63,729,888 I172V probably benign Het
Tns1 G A 1: 73,925,482 T1330I probably damaging Het
Zc3h6 T A 2: 129,010,433 F330I possibly damaging Het
Zdbf2 A G 1: 63,303,650 E396G possibly damaging Het
Other mutations in Eef1akmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Eef1akmt2 APN 7 132831405 missense probably damaging 1.00
IGL02477:Eef1akmt2 APN 7 132850589 splice site probably null
IGL02984:Eef1akmt2 UTSW 7 132837206 makesense probably null
R0082:Eef1akmt2 UTSW 7 132851472 nonsense probably null
R3843:Eef1akmt2 UTSW 7 132831576 missense probably damaging 1.00
R6234:Eef1akmt2 UTSW 7 132827856 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCACAGAAGCCAGATTCAGC -3'
(R):5'- AGTGTTCATCCGATGGGTATAAGTAC -3'

Sequencing Primer
(F):5'- CCCCGAGCTTCTGAAGAGCTC -3'
(R):5'- ATCCGATGGGTATAAGTACTTGTACG -3'
Posted On2017-02-01