Incidental Mutation 'IGL03014:Tek'
ID453306
Institutional Source Beutler Lab
Gene Symbol Tek
Ensembl Gene ENSMUSG00000006386
Gene NameTEK receptor tyrosine kinase
SynonymsCd202b, Hyk, tie-2, Tie2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #IGL03014 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location94739289-94874976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94827263 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 346 (D346G)
Ref Sequence ENSEMBL: ENSMUSP00000073595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071168] [ENSMUST00000073939] [ENSMUST00000102798]
Predicted Effect probably benign
Transcript: ENSMUST00000071168
AA Change: D397G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000071162
Gene: ENSMUSG00000006386
AA Change: D397G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_Tie2_1 23 118 1.2e-57 PFAM
IG_like 128 209 6.52e0 SMART
EGF_Lam 227 264 1.26e-2 SMART
EGF 267 299 2.2e1 SMART
internal_repeat_1 302 346 4.35e-7 PROSPERO
IG_like 356 442 3.29e1 SMART
FN3 445 526 2.11e0 SMART
FN3 541 624 9.77e-5 SMART
FN3 638 720 1.18e-12 SMART
transmembrane domain 747 769 N/A INTRINSIC
TyrKc 822 1090 1.9e-138 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073939
AA Change: D346G

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000073595
Gene: ENSMUSG00000006386
AA Change: D346G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_Tie2_1 23 118 7.1e-58 PFAM
EGF_Lam 176 213 1.26e-2 SMART
EGF 216 248 2.2e1 SMART
internal_repeat_1 251 295 4.22e-7 PROSPERO
FN3 394 475 2.11e0 SMART
FN3 490 573 9.77e-5 SMART
FN3 587 669 1.18e-12 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 772 1040 1.9e-138 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102798
AA Change: D397G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099862
Gene: ENSMUSG00000006386
AA Change: D397G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_Tie2_1 24 118 5e-44 PFAM
IG_like 128 209 6.52e0 SMART
EGF_Lam 227 264 1.26e-2 SMART
EGF 267 299 2.2e1 SMART
internal_repeat_1 302 346 4.36e-7 PROSPERO
IG_like 356 442 3.29e1 SMART
FN3 445 526 2.11e0 SMART
FN3 541 624 9.77e-5 SMART
FN3 638 720 1.18e-12 SMART
transmembrane domain 747 769 N/A INTRINSIC
TyrKc 823 1091 1.9e-138 SMART
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor that belongs to the protein tyrosine kinase Tie2 family. The encoded protein possesses a unique extracellular region that contains two immunoglobulin-like domains, three epidermal growth factor (EGF)-like domains and three fibronectin type III repeats. The ligand angiopoietin-1 binds to this receptor and mediates a signaling pathway that functions in embryonic vascular development. Mutations in this gene are associated with inherited venous malformations of the skin and mucous membranes. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during organogenesis, impaired vascular branching in the embryo and yolk sac, abnormal cardiac development, and in some cases hemorrhages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,431,608 *675Q probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
AW112010 A G 19: 11,048,092 noncoding transcript Het
BC003331 C A 1: 150,383,053 probably benign Het
Ccdc134 T C 15: 82,130,105 L13P probably damaging Het
Ccdc150 G T 1: 54,290,702 V395F probably damaging Het
Cdh22 G T 2: 165,112,411 S730* probably null Het
Chrng G T 1: 87,211,037 probably null Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Csmd2 G T 4: 128,296,429 M387I probably benign Het
Cux1 T C 5: 136,565,525 probably benign Het
D130043K22Rik C T 13: 24,858,092 P335S possibly damaging Het
Dctn1 A G 6: 83,197,369 probably benign Het
Dock11 G T X: 36,047,046 probably benign Het
Dsn1 A T 2: 156,996,819 M292K possibly damaging Het
Efemp1 A G 11: 28,926,218 Y461C probably damaging Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Fbln2 T C 6: 91,265,919 probably benign Het
Fcna G C 2: 25,630,681 probably benign Het
Hecw1 T A 13: 14,245,808 Y1010F probably damaging Het
Igha A G 12: 113,259,093 V236A unknown Het
Igsf9b T C 9: 27,322,636 M377T probably benign Het
Itga9 A G 9: 118,628,144 T108A probably benign Het
Kcna3 A T 3: 107,037,890 M490L probably benign Het
Lama3 A T 18: 12,539,967 Y886F possibly damaging Het
Lcorl T C 5: 45,774,029 probably benign Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Olfr33 A T 7: 102,713,546 V289E probably null Het
Olfr43 G A 11: 74,206,827 L130F probably damaging Het
Pex10 A G 4: 155,070,619 probably benign Het
Plcl2 G A 17: 50,611,001 V943M possibly damaging Het
Prkcd T A 14: 30,607,337 T164S probably damaging Het
Ptprn2 T A 12: 117,248,688 L910Q probably damaging Het
Rab1b T C 19: 5,104,895 I41V probably benign Het
Scpep1 T A 11: 88,933,445 probably null Het
Sergef T C 7: 46,590,756 T288A probably damaging Het
Setdb1 G A 3: 95,341,415 P397S probably damaging Het
Setx T A 2: 29,139,411 D230E probably damaging Het
Sin3a C A 9: 57,095,255 probably benign Het
Smad5 T C 13: 56,735,941 L380P probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stard9 A T 2: 120,702,194 probably benign Het
Trav7d-4 T A 14: 52,769,896 W12R unknown Het
Trmt1l G T 1: 151,457,930 W728L probably damaging Het
Ubash3a C A 17: 31,239,224 T559K probably damaging Het
Vmn1r72 T A 7: 11,669,784 I246F possibly damaging Het
Zfp618 A T 4: 63,080,088 Q109L probably damaging Het
Other mutations in Tek
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Tek APN 4 94827301 missense probably benign 0.03
IGL00805:Tek APN 4 94798719 missense probably damaging 1.00
IGL00806:Tek APN 4 94798719 missense probably damaging 1.00
IGL00807:Tek APN 4 94798719 missense probably damaging 1.00
IGL00870:Tek APN 4 94873081 nonsense probably null
IGL01348:Tek APN 4 94859658 missense probably damaging 1.00
IGL01398:Tek APN 4 94849777 missense probably damaging 1.00
IGL01683:Tek APN 4 94858911 missense probably damaging 1.00
IGL01827:Tek APN 4 94739645 missense probably benign 0.24
IGL02063:Tek APN 4 94739645 missense probably benign 0.24
IGL02218:Tek APN 4 94855337 missense probably damaging 1.00
IGL02502:Tek APN 4 94853581 critical splice donor site probably null
IGL02852:Tek APN 4 94855324 missense probably damaging 1.00
IGL02995:Tek APN 4 94739640 utr 5 prime probably benign
IGL03182:Tek APN 4 94851765 missense probably damaging 1.00
IGL03247:Tek APN 4 94865443 missense possibly damaging 0.85
R0022:Tek UTSW 4 94837272 missense probably damaging 0.98
R0373:Tek UTSW 4 94804341 missense probably damaging 1.00
R0479:Tek UTSW 4 94804312 missense probably benign 0.01
R1178:Tek UTSW 4 94804287 missense probably damaging 1.00
R1289:Tek UTSW 4 94804830 missense probably damaging 1.00
R1331:Tek UTSW 4 94739706 splice site probably benign
R1502:Tek UTSW 4 94781102 missense probably damaging 1.00
R1606:Tek UTSW 4 94849767 missense probably damaging 0.99
R2073:Tek UTSW 4 94827729 missense probably benign 0.01
R2075:Tek UTSW 4 94827729 missense probably benign 0.01
R2230:Tek UTSW 4 94811336 missense probably damaging 1.00
R2851:Tek UTSW 4 94820224 missense probably benign 0.30
R2852:Tek UTSW 4 94820224 missense probably benign 0.30
R3775:Tek UTSW 4 94804312 missense probably benign 0.01
R3845:Tek UTSW 4 94804872 missense probably damaging 1.00
R4114:Tek UTSW 4 94849683 missense probably damaging 0.99
R4115:Tek UTSW 4 94849683 missense probably damaging 0.99
R4273:Tek UTSW 4 94829970 missense probably damaging 1.00
R4425:Tek UTSW 4 94863667 missense probably damaging 1.00
R4488:Tek UTSW 4 94849756 missense possibly damaging 0.72
R4579:Tek UTSW 4 94863666 nonsense probably null
R4623:Tek UTSW 4 94863661 missense probably damaging 1.00
R4651:Tek UTSW 4 94780884 missense probably damaging 1.00
R4652:Tek UTSW 4 94780884 missense probably damaging 1.00
R4723:Tek UTSW 4 94799160 missense possibly damaging 0.71
R5059:Tek UTSW 4 94804314 missense probably benign 0.10
R5652:Tek UTSW 4 94855324 missense probably damaging 1.00
R5793:Tek UTSW 4 94820096 missense probably benign 0.01
R5855:Tek UTSW 4 94853553 missense probably damaging 1.00
R5912:Tek UTSW 4 94798640 missense probably damaging 1.00
R6537:Tek UTSW 4 94837324 missense probably benign 0.19
R6727:Tek UTSW 4 94853495 nonsense probably null
R6835:Tek UTSW 4 94853434 missense possibly damaging 0.94
R6885:Tek UTSW 4 94837189 missense possibly damaging 0.89
R6887:Tek UTSW 4 94804944 missense probably damaging 1.00
R7027:Tek UTSW 4 94865510 missense probably damaging 1.00
R7108:Tek UTSW 4 94853487 missense not run
R7121:Tek UTSW 4 94811410 missense not run
Predicted Primers PCR Primer
(F):5'- ACTTTCAGGGCTGCTACAATAG -3'
(R):5'- TTGTGCCATGACTCAGCAG -3'

Sequencing Primer
(F):5'- CCTCAGTCTCTCCTAGAAAAC -3'
(R):5'- CACTGCTTCAAGAAAGTGCCCTTG -3'
Posted On2017-02-01