Incidental Mutation 'IGL03014:4930452B06Rik'
List |< first << previous [record 16 of 958] next >> last >|
ID453334
Institutional Source Beutler Lab
Gene Symbol 4930452B06Rik
Ensembl Gene ENSMUSG00000021747
Gene NameRIKEN cDNA 4930452B06 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #IGL03014 (G1)
Quality Score210
Status Validated
Chromosome14
Chromosomal Location8431192-8666240 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 8431608 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 675 (*675Q)
Ref Sequence ENSEMBL: ENSMUSP00000100061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102996]
Predicted Effect probably null
Transcript: ENSMUST00000102996
AA Change: *675Q
SMART Domains Protein: ENSMUSP00000100061
Gene: ENSMUSG00000021747
AA Change: *675Q

DomainStartEndE-ValueType
Pfam:DUF667 1 188 1.7e-43 PFAM
low complexity region 344 358 N/A INTRINSIC
low complexity region 506 519 N/A INTRINSIC
low complexity region 568 578 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 639 650 N/A INTRINSIC
Meta Mutation Damage Score 0.458 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
AW112010 A G 19: 11,048,092 noncoding transcript Het
BC003331 C A 1: 150,383,053 Het
Ccdc134 T C 15: 82,130,105 L13P probably damaging Het
Ccdc150 G T 1: 54,290,702 V395F probably damaging Het
Cdh22 G T 2: 165,112,411 S730* probably null Het
Chrng G T 1: 87,211,037 probably null Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Csmd2 G T 4: 128,296,429 M387I probably benign Het
Cux1 T C 5: 136,565,525 probably benign Het
D130043K22Rik C T 13: 24,858,092 P335S possibly damaging Het
Dctn1 A G 6: 83,197,369 probably benign Het
Dock11 G T X: 36,047,046 Het
Dsn1 A T 2: 156,996,819 M292K possibly damaging Het
Efemp1 A G 11: 28,926,218 Y461C probably damaging Het
Efl1 A G 7: 82,651,886 T33A probably damaging Het
Fbln2 T C 6: 91,265,919 probably benign Het
Fcna G C 2: 25,630,681 probably benign Het
Hecw1 T A 13: 14,245,808 Y1010F probably damaging Het
Igha A G 12: 113,259,093 V236A unknown Het
Igsf9b T C 9: 27,322,636 M377T probably benign Het
Itga9 A G 9: 118,628,144 T108A probably benign Het
Kcna3 A T 3: 107,037,890 M490L probably benign Het
Lama3 A T 18: 12,539,967 Y886F possibly damaging Het
Lcorl T C 5: 45,774,029 probably benign Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Olfr33 A T 7: 102,713,546 V289E probably null Het
Olfr43 G A 11: 74,206,827 L130F probably damaging Het
Pex10 A G 4: 155,070,619 probably benign Het
Plcl2 G A 17: 50,611,001 V943M possibly damaging Het
Prkcd T A 14: 30,607,337 T164S probably damaging Het
Ptprn2 T A 12: 117,248,688 L910Q probably damaging Het
Rab1b T C 19: 5,104,895 I41V probably benign Het
Scpep1 T A 11: 88,933,445 probably null Het
Sergef T C 7: 46,590,756 T288A probably damaging Het
Setdb1 G A 3: 95,341,415 P397S probably damaging Het
Setx T A 2: 29,139,411 D230E probably damaging Het
Sin3a C A 9: 57,095,255 probably benign Het
Smad5 T C 13: 56,735,941 L380P probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stard9 A T 2: 120,702,194 probably benign Het
Tek A G 4: 94,827,263 D346G probably benign Het
Trav7d-4 T A 14: 52,769,896 W12R unknown Het
Trmt1l G T 1: 151,457,930 W728L probably damaging Het
Ubash3a C A 17: 31,239,224 T559K probably damaging Het
Vmn1r72 T A 7: 11,669,784 I246F possibly damaging Het
Zfp618 A T 4: 63,080,088 Q109L probably damaging Het
Other mutations in 4930452B06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:4930452B06Rik APN 14 8473370 missense possibly damaging 0.57
IGL02010:4930452B06Rik APN 14 8578384 missense possibly damaging 0.68
IGL02385:4930452B06Rik APN 14 8510920 missense possibly damaging 0.59
IGL02431:4930452B06Rik APN 14 8659424 missense probably damaging 1.00
IGL02723:4930452B06Rik APN 14 8516507 missense probably benign 0.02
IGL02865:4930452B06Rik APN 14 8517940 missense probably benign 0.00
IGL03030:4930452B06Rik APN 14 8511113 missense probably damaging 1.00
IGL03204:4930452B06Rik APN 14 8644436 missense possibly damaging 0.68
R0197:4930452B06Rik UTSW 14 8518695 missense probably damaging 1.00
R0265:4930452B06Rik UTSW 14 8431667 missense probably damaging 1.00
R0513:4930452B06Rik UTSW 14 8536609 missense probably damaging 1.00
R0647:4930452B06Rik UTSW 14 8536655 missense possibly damaging 0.94
R1168:4930452B06Rik UTSW 14 8442939 missense probably benign 0.22
R1610:4930452B06Rik UTSW 14 8511110 missense probably benign 0.00
R1625:4930452B06Rik UTSW 14 8431668 missense probably damaging 1.00
R2010:4930452B06Rik UTSW 14 8511021 missense probably damaging 1.00
R2084:4930452B06Rik UTSW 14 8558171 missense probably damaging 1.00
R2174:4930452B06Rik UTSW 14 8558109 missense probably benign 0.02
R3802:4930452B06Rik UTSW 14 8510931 missense probably benign 0.00
R4244:4930452B06Rik UTSW 14 8482521 missense probably benign 0.00
R4471:4930452B06Rik UTSW 14 8536571 missense probably damaging 1.00
R4516:4930452B06Rik UTSW 14 8536609 missense probably damaging 1.00
R4824:4930452B06Rik UTSW 14 8665997 start codon destroyed probably null 0.93
R4884:4930452B06Rik UTSW 14 8578394 missense probably damaging 0.97
R4975:4930452B06Rik UTSW 14 8518736 missense probably benign 0.00
R5455:4930452B06Rik UTSW 14 8536516 critical splice donor site probably null
R6280:4930452B06Rik UTSW 14 8473414 critical splice acceptor site probably null
R6438:4930452B06Rik UTSW 14 8431701 missense probably damaging 0.98
R6639:4930452B06Rik UTSW 14 8536530 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTTCAAAGCCACGCACTCAG -3'
(R):5'- CTTTGCCTGCATAGAGAAAGC -3'

Sequencing Primer
(F):5'- CAGCTACAAAGAGAATGCAGATGTTC -3'
(R):5'- CTGGGATTGCACTTACGGAATTC -3'
Posted On2017-02-01