Incidental Mutation 'IGL03050:Olfr1012'
ID453424
Institutional Source Beutler Lab
Gene Symbol Olfr1012
Ensembl Gene ENSMUSG00000075210
Gene Nameolfactory receptor 1012
SynonymsGA_x6K02T2Q125-47239120-47238185, MOR213-6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.045) question?
Stock #IGL03050 (G1)
Quality Score185
Status Validated
Chromosome2
Chromosomal Location85757353-85762766 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 85759441 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 312 (*312Q)
Ref Sequence ENSEMBL: ENSMUSP00000148952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099916] [ENSMUST00000214255] [ENSMUST00000214958] [ENSMUST00000216831]
Predicted Effect probably null
Transcript: ENSMUST00000099916
AA Change: *312Q
SMART Domains Protein: ENSMUSP00000097500
Gene: ENSMUSG00000075210
AA Change: *312Q

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 1.7e-47 PFAM
Pfam:7tm_1 40 289 8e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214255
AA Change: *312Q
Predicted Effect probably null
Transcript: ENSMUST00000214958
AA Change: *312Q
Predicted Effect probably benign
Transcript: ENSMUST00000216831
Meta Mutation Damage Score 0.66 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,726,381 V825E probably damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Ankrd2 G A 19: 42,040,094 R63H probably damaging Het
Bbs2 C A 8: 94,074,413 probably benign Het
Btbd7 G T 12: 102,812,806 D400E probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col17a1 C T 19: 47,648,098 probably null Het
Col3a1 A G 1: 45,328,925 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Dpp8 C G 9: 65,054,836 S386C probably benign Het
Dscaml1 A C 9: 45,742,999 D1443A probably damaging Het
Dsp T C 13: 38,188,445 probably benign Het
Elf2 C T 3: 51,257,617 R262Q probably benign Het
Fat3 G A 9: 15,996,600 S2702F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gabrb1 T A 5: 72,122,154 S347R probably benign Het
Hivep1 T C 13: 42,156,128 S615P probably benign Het
Kcnq3 T C 15: 66,025,178 D291G possibly damaging Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mirt1 A G 19: 53,445,279 noncoding transcript Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mug1 T A 6: 121,880,571 S1085T possibly damaging Het
Myo18a A T 11: 77,818,770 T190S probably benign Het
Myo5a G A 9: 75,146,909 probably null Het
Olfr1434 G T 19: 12,283,512 V155L probably benign Het
Olfr24 A T 9: 18,755,454 Y60* probably null Het
Olfr355 A T 2: 36,927,808 M102K probably damaging Het
Olfr356 T A 2: 36,937,623 F168Y probably damaging Het
Rgma G A 7: 73,417,515 V173M probably damaging Het
Rgsl1 G A 1: 153,825,676 S379F possibly damaging Het
Sec16a T A 2: 26,415,747 D2215V probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Thrap3 G A 4: 126,165,542 probably null Het
Ttyh2 T A 11: 114,708,854 L370Q probably damaging Het
Ugt8a T C 3: 125,875,490 R322G possibly damaging Het
Vmn2r97 T C 17: 18,947,638 M718T possibly damaging Het
Zhx2 T C 15: 57,822,833 F533L possibly damaging Het
Other mutations in Olfr1012
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01799:Olfr1012 APN 2 85759642 missense probably benign 0.30
IGL02334:Olfr1012 APN 2 85760159 nonsense probably null
R0399:Olfr1012 UTSW 2 85759904 missense possibly damaging 0.53
R1730:Olfr1012 UTSW 2 85760242 missense possibly damaging 0.91
R2142:Olfr1012 UTSW 2 85759677 missense probably benign 0.07
R2185:Olfr1012 UTSW 2 85760019 missense probably damaging 1.00
R2412:Olfr1012 UTSW 2 85759680 missense probably damaging 0.99
R3552:Olfr1012 UTSW 2 85759893 missense possibly damaging 0.46
R3785:Olfr1012 UTSW 2 85759453 missense probably benign 0.00
R4096:Olfr1012 UTSW 2 85759696 missense possibly damaging 0.55
R4097:Olfr1012 UTSW 2 85759696 missense possibly damaging 0.55
R5199:Olfr1012 UTSW 2 85760214 missense probably damaging 1.00
R5206:Olfr1012 UTSW 2 85759623 missense probably benign 0.31
R5444:Olfr1012 UTSW 2 85759919 missense probably benign 0.39
R5567:Olfr1012 UTSW 2 85759650 missense probably damaging 1.00
R5570:Olfr1012 UTSW 2 85759650 missense probably damaging 1.00
R5956:Olfr1012 UTSW 2 85753839 unclassified probably benign
R6406:Olfr1012 UTSW 2 85760307 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCCCTGTCATAATTCCACATGATG -3'
(R):5'- TCTACATCTACTCTCGGCCAAG -3'

Sequencing Primer
(F):5'- TGTCCTATTTCACACTCAATACAAAC -3'
(R):5'- CCAAGTTCCAGTTATTCCTTGGAAAG -3'
Posted On2017-02-08