Incidental Mutation 'IGL03050:Cilp'
ID 453439
Institutional Source Beutler Lab
Gene Symbol Cilp
Ensembl Gene ENSMUSG00000042254
Gene Name cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Synonyms C130036G17Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # IGL03050 (G1)
Quality Score 214
Status Validated
Chromosome 9
Chromosomal Location 65172462-65187887 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TGGG to TGG at 65187412 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048762] [ENSMUST00000141382]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000048762
SMART Domains Protein: ENSMUSP00000036631
Gene: ENSMUSG00000042254

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Mucin2_WxxW 55 139 1.9e-24 PFAM
TSP1 152 201 3.09e-10 SMART
low complexity region 233 242 N/A INTRINSIC
IGc2 321 383 4.45e-10 SMART
low complexity region 1154 1170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141382
SMART Domains Protein: ENSMUSP00000121326
Gene: ENSMUSG00000042254

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major alterations in the composition of the cartilage extracellular matrix occur in joint disease, such as osteoarthrosis. This gene encodes the cartilage intermediate layer protein (CILP), which increases in early osteoarthrosis cartilage. The encoded protein was thought to encode a protein precursor for two different proteins; an N-terminal CILP and a C-terminal homolog of NTPPHase, however, later studies identified no nucleotide pyrophosphatase phosphodiesterase (NPP) activity. The full-length and the N-terminal domain of this protein was shown to function as an IGF-1 antagonist. An allelic variant of this gene has been associated with lumbar disc disease. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416I08Rik TCC TCCC X: 52,692,862 (GRCm39) noncoding transcript Het
Ankrd2 G A 19: 42,028,533 (GRCm39) R63H probably damaging Het
Bbs2 C A 8: 94,801,041 (GRCm39) probably benign Het
Btbd7 G T 12: 102,779,065 (GRCm39) D400E probably benign Het
Col17a1 C T 19: 47,636,537 (GRCm39) probably null Het
Col3a1 A G 1: 45,368,085 (GRCm39) probably null Het
Crb1 CG C 1: 139,164,824 (GRCm39) probably null Het
Dpp8 C G 9: 64,962,118 (GRCm39) S386C probably benign Het
Dscaml1 A C 9: 45,654,297 (GRCm39) D1443A probably damaging Het
Dsp T C 13: 38,372,421 (GRCm39) probably benign Het
Elf2 C T 3: 51,165,038 (GRCm39) R262Q probably benign Het
Fat3 G A 9: 15,907,896 (GRCm39) S2702F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,504,945 (GRCm39) probably null Het
Gabrb1 T A 5: 72,279,497 (GRCm39) S347R probably benign Het
Hivep1 T C 13: 42,309,604 (GRCm39) S615P probably benign Het
Kcnq3 T C 15: 65,897,027 (GRCm39) D291G possibly damaging Het
Lyl1 C T 8: 85,429,300 (GRCm39) P3L possibly damaging Het
Mirt1 A G 19: 53,433,710 (GRCm39) noncoding transcript Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Mug1 T A 6: 121,857,530 (GRCm39) S1085T possibly damaging Het
Myo18a A T 11: 77,709,596 (GRCm39) T190S probably benign Het
Myo5a G A 9: 75,054,191 (GRCm39) probably null Het
Or1ak2 T A 2: 36,827,635 (GRCm39) F168Y probably damaging Het
Or1l8 A T 2: 36,817,820 (GRCm39) M102K probably damaging Het
Or1m1 A T 9: 18,666,750 (GRCm39) Y60* probably null Het
Or5an1 G T 19: 12,260,876 (GRCm39) V155L probably benign Het
Or9g3 A G 2: 85,589,785 (GRCm39) *312Q probably null Het
Relch T A 1: 105,654,106 (GRCm39) V825E probably damaging Het
Rgma G A 7: 73,067,263 (GRCm39) V173M probably damaging Het
Rgsl1 G A 1: 153,701,422 (GRCm39) S379F possibly damaging Het
Sec16a T A 2: 26,305,759 (GRCm39) D2215V probably damaging Het
Speer4c1 A C 5: 15,919,214 (GRCm39) probably benign Het
Thrap3 G A 4: 126,059,335 (GRCm39) probably null Het
Ttyh2 T A 11: 114,599,680 (GRCm39) L370Q probably damaging Het
Ugt8a T C 3: 125,669,139 (GRCm39) R322G possibly damaging Het
Vmn2r97 T C 17: 19,167,900 (GRCm39) M718T possibly damaging Het
Zhx2 T C 15: 57,686,229 (GRCm39) F533L possibly damaging Het
Other mutations in Cilp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Cilp APN 9 65,186,265 (GRCm39) missense possibly damaging 0.80
IGL01340:Cilp APN 9 65,183,256 (GRCm39) missense probably damaging 0.99
IGL02330:Cilp APN 9 65,181,804 (GRCm39) splice site probably benign
IGL02729:Cilp APN 9 65,185,372 (GRCm39) missense possibly damaging 0.63
IGL02833:Cilp APN 9 65,185,206 (GRCm39) missense probably benign
IGL02961:Cilp APN 9 65,185,891 (GRCm39) missense possibly damaging 0.88
IGL03137:Cilp APN 9 65,185,450 (GRCm39) missense probably benign
IGL03211:Cilp APN 9 65,187,457 (GRCm39) missense probably benign
IGL03301:Cilp APN 9 65,187,499 (GRCm39) missense probably benign 0.01
IGL03341:Cilp APN 9 65,185,284 (GRCm39) missense probably benign 0.07
ANU05:Cilp UTSW 9 65,186,265 (GRCm39) missense possibly damaging 0.80
IGL02984:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL02988:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL02991:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03014:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03054:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03055:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03097:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03098:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03134:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03138:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03147:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
R0096:Cilp UTSW 9 65,180,952 (GRCm39) missense possibly damaging 0.57
R0219:Cilp UTSW 9 65,176,872 (GRCm39) missense possibly damaging 0.64
R0347:Cilp UTSW 9 65,187,435 (GRCm39) missense probably benign
R0699:Cilp UTSW 9 65,177,608 (GRCm39) missense probably damaging 1.00
R1148:Cilp UTSW 9 65,187,598 (GRCm39) missense possibly damaging 0.96
R1148:Cilp UTSW 9 65,187,598 (GRCm39) missense possibly damaging 0.96
R1155:Cilp UTSW 9 65,176,869 (GRCm39) missense probably benign 0.01
R1544:Cilp UTSW 9 65,183,127 (GRCm39) missense probably benign 0.03
R1584:Cilp UTSW 9 65,186,997 (GRCm39) missense probably damaging 1.00
R1586:Cilp UTSW 9 65,186,997 (GRCm39) missense probably damaging 1.00
R2055:Cilp UTSW 9 65,186,997 (GRCm39) missense probably damaging 1.00
R2069:Cilp UTSW 9 65,185,372 (GRCm39) missense possibly damaging 0.63
R2070:Cilp UTSW 9 65,186,377 (GRCm39) missense probably damaging 1.00
R2414:Cilp UTSW 9 65,181,927 (GRCm39) splice site probably benign
R4284:Cilp UTSW 9 65,185,560 (GRCm39) missense probably damaging 1.00
R4630:Cilp UTSW 9 65,187,162 (GRCm39) missense probably benign 0.17
R4632:Cilp UTSW 9 65,187,162 (GRCm39) missense probably benign 0.17
R4870:Cilp UTSW 9 65,186,980 (GRCm39) missense probably damaging 1.00
R4908:Cilp UTSW 9 65,185,302 (GRCm39) missense probably benign 0.17
R5568:Cilp UTSW 9 65,187,515 (GRCm39) missense probably benign 0.04
R5621:Cilp UTSW 9 65,186,073 (GRCm39) missense possibly damaging 0.71
R5889:Cilp UTSW 9 65,187,625 (GRCm39) missense possibly damaging 0.93
R6645:Cilp UTSW 9 65,186,587 (GRCm39) missense possibly damaging 0.66
R6878:Cilp UTSW 9 65,187,129 (GRCm39) missense probably damaging 1.00
R6982:Cilp UTSW 9 65,187,087 (GRCm39) missense probably damaging 1.00
R7330:Cilp UTSW 9 65,187,527 (GRCm39) missense probably benign
R7967:Cilp UTSW 9 65,185,494 (GRCm39) missense possibly damaging 0.80
R8305:Cilp UTSW 9 65,186,286 (GRCm39) missense probably damaging 0.98
R8306:Cilp UTSW 9 65,186,286 (GRCm39) missense probably damaging 0.98
R8307:Cilp UTSW 9 65,186,286 (GRCm39) missense probably damaging 0.98
R8308:Cilp UTSW 9 65,186,286 (GRCm39) missense probably damaging 0.98
R8386:Cilp UTSW 9 65,186,286 (GRCm39) missense probably damaging 0.98
R8407:Cilp UTSW 9 65,181,898 (GRCm39) missense probably damaging 1.00
R8542:Cilp UTSW 9 65,185,405 (GRCm39) missense probably damaging 1.00
R8794:Cilp UTSW 9 65,186,535 (GRCm39) missense probably benign 0.26
R8951:Cilp UTSW 9 65,180,220 (GRCm39) missense probably benign 0.01
R9060:Cilp UTSW 9 65,186,302 (GRCm39) missense probably benign 0.01
R9257:Cilp UTSW 9 65,174,451 (GRCm39) missense possibly damaging 0.72
R9265:Cilp UTSW 9 65,187,333 (GRCm39) missense probably benign
R9358:Cilp UTSW 9 65,183,269 (GRCm39) missense probably benign
R9401:Cilp UTSW 9 65,185,381 (GRCm39) missense probably damaging 0.98
X0024:Cilp UTSW 9 65,186,925 (GRCm39) missense probably damaging 1.00
X0025:Cilp UTSW 9 65,186,980 (GRCm39) missense probably damaging 1.00
Z1088:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
Z1176:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
Z1177:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTCCTCCAGAATCATGAAGAGC -3'
(R):5'- TCAGCATCATGAGGCAGAGAC -3'

Sequencing Primer
(F):5'- CCTCCAGAATCATGAAGAGCAATGTG -3'
(R):5'- CATCATGAGGCAGAGACAGTAAG -3'
Posted On 2017-02-08