Incidental Mutation 'IGL03050:Btbd7'
ID453444
Institutional Source Beutler Lab
Gene Symbol Btbd7
Ensembl Gene ENSMUSG00000041702
Gene NameBTB (POZ) domain containing 7
SynonymsFUP1, E130118E17Rik, 5730507E09Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #IGL03050 (G1)
Quality Score115
Status Validated
Chromosome12
Chromosomal Location102780797-102878471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 102812806 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 400 (D400E)
Ref Sequence ENSEMBL: ENSMUSP00000152426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045652] [ENSMUST00000223554]
Predicted Effect probably benign
Transcript: ENSMUST00000045652
AA Change: D400E

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000046951
Gene: ENSMUSG00000041702
AA Change: D400E

DomainStartEndE-ValueType
BTB 142 244 1.57e-13 SMART
BTB 247 397 2.23e-4 SMART
BACK 402 538 1.49e-4 SMART
low complexity region 626 640 N/A INTRINSIC
low complexity region 756 771 N/A INTRINSIC
low complexity region 783 792 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 839 850 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221925
Predicted Effect probably benign
Transcript: ENSMUST00000223554
AA Change: D400E

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.1256 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,726,381 V825E probably damaging Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Ankrd2 G A 19: 42,040,094 R63H probably damaging Het
Bbs2 C A 8: 94,074,413 probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Col17a1 C T 19: 47,648,098 probably null Het
Col3a1 A G 1: 45,328,925 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Dpp8 C G 9: 65,054,836 S386C probably benign Het
Dscaml1 A C 9: 45,742,999 D1443A probably damaging Het
Dsp T C 13: 38,188,445 probably benign Het
Elf2 C T 3: 51,257,617 R262Q probably benign Het
Fat3 G A 9: 15,996,600 S2702F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gabrb1 T A 5: 72,122,154 S347R probably benign Het
Hivep1 T C 13: 42,156,128 S615P probably benign Het
Kcnq3 T C 15: 66,025,178 D291G possibly damaging Het
Lyl1 C T 8: 84,702,671 P3L possibly damaging Het
Mirt1 A G 19: 53,445,279 noncoding transcript Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mug1 T A 6: 121,880,571 S1085T possibly damaging Het
Myo18a A T 11: 77,818,770 T190S probably benign Het
Myo5a G A 9: 75,146,909 probably null Het
Olfr1012 A G 2: 85,759,441 *312Q probably null Het
Olfr1434 G T 19: 12,283,512 V155L probably benign Het
Olfr24 A T 9: 18,755,454 Y60* probably null Het
Olfr355 A T 2: 36,927,808 M102K probably damaging Het
Olfr356 T A 2: 36,937,623 F168Y probably damaging Het
Rgma G A 7: 73,417,515 V173M probably damaging Het
Rgsl1 G A 1: 153,825,676 S379F possibly damaging Het
Sec16a T A 2: 26,415,747 D2215V probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Thrap3 G A 4: 126,165,542 probably null Het
Ttyh2 T A 11: 114,708,854 L370Q probably damaging Het
Ugt8a T C 3: 125,875,490 R322G possibly damaging Het
Vmn2r97 T C 17: 18,947,638 M718T possibly damaging Het
Zhx2 T C 15: 57,822,833 F533L possibly damaging Het
Other mutations in Btbd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Btbd7 APN 12 102793779 missense probably benign 0.10
IGL02899:Btbd7 APN 12 102837662 missense probably damaging 1.00
IGL03204:Btbd7 APN 12 102807980 nonsense probably null
H8562:Btbd7 UTSW 12 102788302 missense probably benign 0.26
R1262:Btbd7 UTSW 12 102787951 missense probably benign
R1423:Btbd7 UTSW 12 102785475 missense possibly damaging 0.49
R1437:Btbd7 UTSW 12 102788090 missense possibly damaging 0.59
R1636:Btbd7 UTSW 12 102793851 missense probably damaging 1.00
R1641:Btbd7 UTSW 12 102790775 missense probably damaging 1.00
R1722:Btbd7 UTSW 12 102812654 missense possibly damaging 0.96
R1921:Btbd7 UTSW 12 102793796 missense probably benign 0.01
R2021:Btbd7 UTSW 12 102790709 missense probably damaging 1.00
R2180:Btbd7 UTSW 12 102785897 missense probably damaging 1.00
R3768:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3770:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3786:Btbd7 UTSW 12 102838152 missense probably benign 0.22
R4396:Btbd7 UTSW 12 102785293 missense probably benign 0.00
R4809:Btbd7 UTSW 12 102793744 critical splice donor site probably null
R4910:Btbd7 UTSW 12 102808048 missense probably damaging 0.98
R4915:Btbd7 UTSW 12 102837787 nonsense probably null
R5054:Btbd7 UTSW 12 102838212 missense probably benign 0.02
R5276:Btbd7 UTSW 12 102838392 missense probably benign 0.00
R5387:Btbd7 UTSW 12 102837785 missense probably damaging 0.99
R5665:Btbd7 UTSW 12 102785197 missense probably benign
R7083:Btbd7 UTSW 12 102788335 missense probably damaging 0.99
X0024:Btbd7 UTSW 12 102812686 nonsense probably null
X0025:Btbd7 UTSW 12 102811164 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATGACGAACTTCTTTGTGCACAC -3'
(R):5'- TTGTTAACCTGTCCCACGAAG -3'

Sequencing Primer
(F):5'- CTTTGTGCACACAGGATGAC -3'
(R):5'- AACCTGTCCCACGAAGTCTTGATG -3'
Posted On2017-02-08