Incidental Mutation 'R0554:Raf1'
ID45345
Institutional Source Beutler Lab
Gene Symbol Raf1
Ensembl Gene ENSMUSG00000000441
Gene Namev-raf-leukemia viral oncogene 1
Synonyms6430402F14Rik, Craf1, sarcoma 3611 oncogene, c-Raf, v-Raf, Raf-1
MMRRC Submission 038746-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0554 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location115618067-115676635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115623530 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 376 (I376T)
Ref Sequence ENSEMBL: ENSMUSP00000108571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000449] [ENSMUST00000000451] [ENSMUST00000112949] [ENSMUST00000203759]
Predicted Effect probably benign
Transcript: ENSMUST00000000449
SMART Domains Protein: ENSMUSP00000000449
Gene: ENSMUSG00000000439

DomainStartEndE-ValueType
ZnF_C3H1 2 28 5.02e-6 SMART
ZnF_C3H1 32 57 1.75e-5 SMART
low complexity region 58 85 N/A INTRINSIC
ZnF_C3H1 165 191 2.79e-4 SMART
RING 238 291 5.82e-6 SMART
ZnF_C3H1 322 349 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000000451
AA Change: I376T

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000000451
Gene: ENSMUSG00000000441
AA Change: I376T

DomainStartEndE-ValueType
RBD 56 131 6.95e-35 SMART
C1 139 184 1.2e-13 SMART
low complexity region 283 301 N/A INTRINSIC
Pfam:Pkinase 349 606 7.2e-61 PFAM
Pfam:Pkinase_Tyr 349 606 3.5e-65 PFAM
Pfam:Kinase-like 400 596 3.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112949
AA Change: I376T

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000108571
Gene: ENSMUSG00000000441
AA Change: I376T

DomainStartEndE-ValueType
RBD 56 131 6.95e-35 SMART
C1 139 184 1.2e-13 SMART
low complexity region 283 301 N/A INTRINSIC
Pfam:Pkinase_Tyr 349 606 3.4e-64 PFAM
Pfam:Pkinase 349 608 1.1e-61 PFAM
Pfam:Kinase-like 399 596 2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130528
Predicted Effect unknown
Transcript: ENSMUST00000147979
AA Change: I202T
SMART Domains Protein: ENSMUSP00000115424
Gene: ENSMUSG00000000441
AA Change: I202T

DomainStartEndE-ValueType
Blast:RBD 2 28 9e-7 BLAST
PDB:4IHL|P 36 71 1e-9 PDB
low complexity region 110 128 N/A INTRINSIC
PDB:3OMV|B 150 205 6e-33 PDB
SCOP:d1b6cb_ 153 205 3e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000203142
AA Change: I5T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203276
Predicted Effect probably benign
Transcript: ENSMUST00000203759
SMART Domains Protein: ENSMUSP00000145520
Gene: ENSMUSG00000000441

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 58 1e-6 PFAM
Pfam:Pkinase 1 60 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204512
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the cellular homolog of viral raf gene (v-raf). The encoded protein is a MAP kinase kinase kinase (MAP3K), which functions downstream of the Ras family of membrane associated GTPases to which it binds directly. Once activated, the cellular RAF1 protein can phosphorylate to activate the dual specificity protein kinases MEK1 and MEK2, which in turn phosphorylate to activate the serine/threonine specific protein kinases, ERK1 and ERK2. Activated ERKs are pleiotropic effectors of cell physiology and play an important role in the control of gene expression involved in the cell division cycle, apoptosis, cell differentiation and cell migration. Mutations in this gene are associated with Noonan syndrome 5 and LEOPARD syndrome 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are growth retarded, with hypocellular fetal livers, placental anomalies, and defects of skin and lungs, resulting in lethality around mid-gestation. Mice heterozygous for a knock-in allele exhibit hypertrophic cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,371 Y255* probably null Het
1810024B03Rik A G 2: 127,187,276 M1T probably null Het
4930503L19Rik T C 18: 70,467,380 D386G probably damaging Het
Ace2 T A X: 164,175,951 N601K probably benign Het
Adam4 A C 12: 81,421,424 I141R probably damaging Het
Adcy10 G A 1: 165,513,130 G235S probably benign Het
Adcy5 G A 16: 35,294,017 V997I probably benign Het
Aff2 T G X: 69,864,074 W1221G possibly damaging Het
Ankrd44 T C 1: 54,763,758 N194D probably benign Het
Apba2 T G 7: 64,745,780 L668R probably damaging Het
Asph T C 4: 9,604,581 D152G probably damaging Het
Bcl3 C G 7: 19,820,066 V126L probably benign Het
Cd163 A G 6: 124,312,660 T446A probably benign Het
Cd209g C T 8: 4,134,995 probably benign Het
Cdadc1 A T 14: 59,586,452 V197E probably damaging Het
CN725425 T C 15: 91,260,763 C610R possibly damaging Het
Col6a2 A G 10: 76,611,161 probably null Het
Coro7 A G 16: 4,632,257 L576P possibly damaging Het
Dgkb T A 12: 38,216,031 V503E probably benign Het
Dhx57 A T 17: 80,260,236 L806* probably null Het
Dlec1 T C 9: 119,115,002 V373A probably benign Het
Dnah11 G T 12: 117,931,178 R3645S probably benign Het
Dnhd1 T C 7: 105,694,395 S1649P probably benign Het
Draxin T G 4: 148,107,963 K297N probably damaging Het
Epha7 T C 4: 28,951,401 S841P probably damaging Het
Esp8 T G 17: 40,530,275 D142E unknown Het
F5 T G 1: 164,179,449 V274G probably damaging Het
Fancc T C 13: 63,317,469 S475G probably benign Het
Fmo3 T C 1: 162,954,332 N484S probably benign Het
Focad T C 4: 88,348,889 Y1046H unknown Het
Furin C T 7: 80,391,284 G602D probably damaging Het
Fut8 A T 12: 77,364,970 I69L probably benign Het
Gm10436 T C 12: 88,177,558 T162A probably benign Het
Gm4951 G A 18: 60,245,417 R8H probably benign Het
Gnai3 A G 3: 108,123,612 I78T probably benign Het
Gpr182 T C 10: 127,751,071 I4V probably benign Het
Gpr63 T C 4: 25,007,447 M57T probably benign Het
Grm1 T A 10: 10,719,923 T654S probably benign Het
Gtf2h4 T C 17: 35,668,639 T371A probably benign Het
Helq T C 5: 100,790,200 N460S probably benign Het
Hmcn1 T C 1: 150,719,117 N1867S probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Inpp5j A G 11: 3,499,644 Y713H probably damaging Het
Ints6 A T 14: 62,704,751 V511D possibly damaging Het
Itga4 A G 2: 79,279,117 Y220C probably damaging Het
Itgav T G 2: 83,794,270 S735A possibly damaging Het
Kctd16 A G 18: 40,258,439 I27V probably benign Het
Klhl6 T C 16: 19,953,593 E334G probably damaging Het
Lrmp G A 6: 145,165,287 A237T probably benign Het
Ltbp1 T A 17: 75,225,279 L116H probably damaging Het
Magohb T A 6: 131,285,697 H98L probably benign Het
Mgat2 A G 12: 69,185,392 T247A probably benign Het
Mtif2 G A 11: 29,533,398 probably null Het
Myrfl T C 10: 116,828,973 E384G probably damaging Het
Nfam1 G T 15: 83,033,209 R8S probably benign Het
Numa1 T C 7: 101,995,524 S236P possibly damaging Het
Olfr1022 T C 2: 85,869,519 F309S probably benign Het
Olfr310 A T 7: 86,269,657 I44N probably damaging Het
Olfr317 T C 11: 58,733,039 N42S probably damaging Het
Olfr777 T C 10: 129,268,499 T275A probably benign Het
Orc4 C T 2: 48,905,421 S431N probably benign Het
Pax2 T C 19: 44,761,861 V129A probably damaging Het
Pcdhb15 A G 18: 37,474,519 D268G probably damaging Het
Pdcd1 G A 1: 94,039,382 R264C probably damaging Het
Pi15 T A 1: 17,621,648 M187K probably benign Het
Plag1 C T 4: 3,904,546 C215Y probably damaging Het
Plagl1 A G 10: 13,127,182 T65A probably benign Het
Prss48 T A 3: 86,000,921 Q18L probably benign Het
Prune2 T A 19: 17,125,218 C2580* probably null Het
Rab40b T A 11: 121,359,606 Q74L probably damaging Het
Rbm46 A T 3: 82,865,268 F186I probably damaging Het
Reps1 C T 10: 18,123,119 T720M possibly damaging Het
Rgs22 A G 15: 36,054,709 M649T probably benign Het
Rhot1 C T 11: 80,243,438 R47* probably null Het
Rhox2f A G X: 37,571,471 Y8C possibly damaging Het
Rnf17 A G 14: 56,522,550 Y1604C probably damaging Het
Rnf40 T C 7: 127,602,584 C943R probably damaging Het
Ropn1l A T 15: 31,451,149 M63K probably benign Het
Sbf2 C A 7: 110,428,287 V501F probably damaging Het
Sh3bp1 T A 15: 78,907,267 M354K probably damaging Het
Sipa1l3 T C 7: 29,388,030 H590R possibly damaging Het
Slco6d1 T A 1: 98,466,697 C369S probably benign Het
Sulf1 T C 1: 12,805,194 Y143H probably damaging Het
Tiam2 A T 17: 3,438,681 R755* probably null Het
Trim12c C A 7: 104,344,962 L228F probably damaging Het
Ttc23l G T 15: 10,530,657 Q290K probably benign Het
Uba3 T C 6: 97,191,260 probably null Het
Ugt1a10 A G 1: 88,056,095 E205G probably damaging Het
Ugt3a2 T A 15: 9,351,120 S72T probably benign Het
Upk3bl C T 5: 136,059,794 T113I probably damaging Het
Uspl1 T A 5: 149,187,834 D20E probably damaging Het
Vmn2r19 G A 6: 123,336,143 G724E probably damaging Het
Vmn2r63 T A 7: 42,933,705 K29* probably null Het
Vwf C T 6: 125,642,781 A1474V probably benign Het
Xpc C T 6: 91,491,226 A860T probably benign Het
Zfp462 A G 4: 55,013,689 H737R probably damaging Het
Zfp536 T C 7: 37,480,819 D787G probably damaging Het
Zfp692 A G 11: 58,314,227 H434R probably damaging Het
Zp1 C A 19: 10,920,562 C5F probably benign Het
Other mutations in Raf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Raf1 APN 6 115676569 unclassified probably benign
IGL02379:Raf1 APN 6 115644548 missense probably benign
IGL02427:Raf1 APN 6 115631327 missense probably benign
IGL02586:Raf1 APN 6 115620306 missense probably damaging 0.98
IGL02620:Raf1 APN 6 115632887 splice site probably benign
P0028:Raf1 UTSW 6 115631205 splice site probably benign
R0044:Raf1 UTSW 6 115623515 missense probably benign 0.12
R0044:Raf1 UTSW 6 115623515 missense probably benign 0.12
R0116:Raf1 UTSW 6 115626383 missense probably damaging 1.00
R0147:Raf1 UTSW 6 115632973 missense probably benign
R0148:Raf1 UTSW 6 115632973 missense probably benign
R0811:Raf1 UTSW 6 115626710 critical splice donor site probably null
R0812:Raf1 UTSW 6 115626710 critical splice donor site probably null
R1070:Raf1 UTSW 6 115637699 missense probably benign 0.00
R4261:Raf1 UTSW 6 115623054 critical splice acceptor site probably null
R4669:Raf1 UTSW 6 115632919 missense probably damaging 1.00
R4846:Raf1 UTSW 6 115644583 missense possibly damaging 0.91
R5038:Raf1 UTSW 6 115620235 nonsense probably null
R5214:Raf1 UTSW 6 115637622 missense possibly damaging 0.82
R5472:Raf1 UTSW 6 115626706 splice site probably null
R5511:Raf1 UTSW 6 115620256 missense probably benign 0.32
R5539:Raf1 UTSW 6 115619356 missense probably damaging 1.00
R5926:Raf1 UTSW 6 115619898 missense probably benign 0.45
R6424:Raf1 UTSW 6 115619581 missense probably benign 0.02
R6649:Raf1 UTSW 6 115631341 missense probably benign 0.03
R7021:Raf1 UTSW 6 115620339 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGGAGGAGGACCGTCCCTTAAAAC -3'
(R):5'- GAGTAGCATTGAAGCGTCTCACCC -3'

Sequencing Primer
(F):5'- CCTTAAAACCCACAGCAGGTG -3'
(R):5'- tggggaggtagaaagggg -3'
Posted On2013-06-11