Incidental Mutation 'R5023:Dnah7a'
ID453524
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Namedynein, axonemal, heavy chain 7A
SynonymsDnahc7a, Dnahc7, LOC381341
MMRRC Submission 042614-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R5023 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location53397006-53706784 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 53647248 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 248 (E248*)
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
Predicted Effect probably null
Transcript: ENSMUST00000094964
AA Change: E248*
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141
AA Change: E248*

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Meta Mutation Damage Score 0.602 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (127/129)
Allele List at MGI
Other mutations in this stock
Total: 124 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,166,755 H739Q probably benign Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Abca8b A G 11: 109,974,988 probably null Het
Adam1b C T 5: 121,501,159 V608M probably damaging Het
Ank2 A G 3: 126,941,871 probably benign Het
Ankrd17 A C 5: 90,282,868 L1019R probably damaging Het
Arih1 T C 9: 59,486,232 N39S unknown Het
Best3 G A 10: 116,988,742 V38I probably benign Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
C1d T A 11: 17,266,674 N135K probably benign Het
Cage1 G T 13: 38,011,411 S778* probably null Het
Capn7 T A 14: 31,352,426 V262E probably damaging Het
Ccdc190 A G 1: 169,933,087 R95G probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Cdh18 G A 15: 23,259,666 S194N probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Ctsw T A 19: 5,466,049 D237V probably damaging Het
Cyp2c68 G A 19: 39,712,507 T289I probably benign Het
Cyp4f39 A G 17: 32,481,104 Y133C probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Eef2kmt T A 16: 5,247,599 D248V probably damaging Het
Ewsr1 T C 11: 5,088,054 T113A possibly damaging Het
Fbxo4 A G 15: 3,977,756 probably null Het
Fbxo43 A T 15: 36,162,929 M44K probably benign Het
Fchsd1 A G 18: 37,964,810 I340T possibly damaging Het
Fgf5 C A 5: 98,262,015 A141E probably damaging Het
Gfm1 T C 3: 67,473,544 V664A probably damaging Het
Glp2r T C 11: 67,741,032 T121A possibly damaging Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm12169 T A 11: 46,528,532 D58E probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm15455 T C 1: 33,837,351 noncoding transcript Het
Gm1818 G C 12: 48,555,535 noncoding transcript Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5155 A T 7: 17,902,706 D236V probably damaging Het
Gm7030 A G 17: 36,109,415 probably benign Het
Gnb2 G A 5: 137,529,940 probably null Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpx5 C T 13: 21,288,745 V140I probably damaging Het
Gtpbp1 A T 15: 79,719,221 Q637L possibly damaging Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hhat A T 1: 192,727,339 L138Q probably damaging Het
Hipk1 G T 3: 103,777,507 T264N probably damaging Het
Hjurp A T 1: 88,275,050 Y71N possibly damaging Het
Hnf4g G T 3: 3,644,587 A144S probably damaging Het
Hook3 TAGAG TAG 8: 26,032,019 probably null Het
Ifi204 G A 1: 173,751,740 T513I possibly damaging Het
Ino80b G T 6: 83,125,042 S26R probably damaging Het
Ints9 T A 14: 64,980,228 L68H probably damaging Het
Isx C T 8: 74,892,714 T178I probably benign Het
Kel A G 6: 41,688,111 L255P probably damaging Het
Klf11 T A 12: 24,655,359 S271T probably benign Het
Klhl20 A C 1: 161,109,220 probably null Het
Lama2 G A 10: 27,190,504 T1127I probably damaging Het
Larp1b T A 3: 41,033,985 N81K possibly damaging Het
Lsm11 T C 11: 45,944,839 D25G probably damaging Het
Map3k20 T A 2: 72,402,345 probably benign Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Milr1 A G 11: 106,766,965 D131G possibly damaging Het
Mybpc1 T G 10: 88,543,774 D635A probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Ndufa7 A G 17: 33,824,603 probably benign Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Neo1 T C 9: 58,990,271 D134G probably damaging Het
Nme4 G A 17: 26,093,668 T129I probably benign Het
Npffr2 A T 5: 89,582,687 T159S probably benign Het
Nup153 A T 13: 46,681,109 probably benign Het
Olfr139 T A 11: 74,045,055 D73V probably damaging Het
Olfr616 A C 7: 103,565,171 M36R possibly damaging Het
Pate2 T C 9: 35,686,111 probably benign Het
Pcca A G 14: 122,790,398 N73D probably damaging Het
Pip5k1c G A 10: 81,310,889 probably null Het
Pkhd1l1 A T 15: 44,528,191 H1551L probably benign Het
Pkhd1l1 G A 15: 44,582,227 M3768I probably benign Het
Ppa2 A G 3: 133,370,434 M275V probably benign Het
Ptpn23 G A 9: 110,388,556 T744I probably benign Het
Ptprv A T 1: 135,124,506 noncoding transcript Het
Rad17 A T 13: 100,645,063 H75Q possibly damaging Het
Rbm44 T C 1: 91,169,098 probably null Het
Rbpj C T 5: 53,649,415 R201W probably damaging Het
Rbpjl C A 2: 164,410,289 L215I probably damaging Het
Ror1 A G 4: 100,425,932 E398G probably benign Het
Scamp3 T A 3: 89,182,293 probably benign Het
Selenot CATGTATG CATGTATGTATG 3: 58,588,453 probably null Het
Siglec15 A G 18: 78,048,675 C104R probably damaging Het
Sis T C 3: 72,934,122 I787V probably benign Het
Slc17a8 T C 10: 89,576,560 D521G probably benign Het
Slc7a10 T A 7: 35,197,355 M172K possibly damaging Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Slitrk3 T C 3: 73,050,648 T264A probably benign Het
Smg8 A C 11: 87,086,137 V206G probably damaging Het
Smg9 A G 7: 24,405,872 K137R possibly damaging Het
Srrm2 C A 17: 23,819,317 probably benign Het
Sult2a2 T A 7: 13,734,860 Y84N possibly damaging Het
Syngr2 A T 11: 117,812,510 I34F probably benign Het
Tank G A 2: 61,578,635 probably benign Het
Tead4 T C 6: 128,294,171 probably benign Het
Tex36 A T 7: 133,595,290 C33S probably benign Het
Timm21 C A 18: 84,949,414 V112L possibly damaging Het
Tmem240 T A 4: 155,739,674 L92Q probably damaging Het
Tmem268 C G 4: 63,568,540 S100C probably damaging Het
Tmod3 G A 9: 75,511,206 P183S probably damaging Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trim16 A T 11: 62,836,812 Y233F probably benign Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ttc3 A G 16: 94,429,359 E450G probably benign Het
Ttk A G 9: 83,863,541 D647G probably damaging Het
Ubash3b A G 9: 41,037,459 C187R possibly damaging Het
Vmn1r29 T A 6: 58,308,067 Y257* probably null Het
Vmn1r33 T C 6: 66,612,105 N155S probably benign Het
Vmn2r28 T A 7: 5,486,464 I459L probably benign Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Vwde T C 6: 13,192,642 I421V possibly damaging Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Zbtb11 A G 16: 56,006,065 Y819C probably damaging Het
Zfp112 A G 7: 24,126,484 T624A probably damaging Het
Zfp592 A G 7: 81,024,347 D353G probably damaging Het
Zfp62 T A 11: 49,215,729 S216T probably damaging Het
Zfp677 A T 17: 21,397,794 H371L probably damaging Het
Zfp780b T C 7: 27,963,448 K561E possibly damaging Het
Zfp936 G A 7: 43,187,257 D31N probably damaging Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Zpbp C T 11: 11,415,248 E200K probably benign Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53419684 missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53501542 missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53457746 missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01322:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01357:Dnah7a APN 1 53662381 missense probably benign
IGL01417:Dnah7a APN 1 53584600 missense probably benign 0.01
IGL01508:Dnah7a APN 1 53627072 missense probably benign 0.00
IGL01511:Dnah7a APN 1 53419595 missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53518782 missense probably benign
IGL01575:Dnah7a APN 1 53427820 splice site probably benign
IGL01667:Dnah7a APN 1 53547292 missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53423270 missense probably benign 0.23
IGL01824:Dnah7a APN 1 53504270 missense probably benign
IGL01829:Dnah7a APN 1 53618068 missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53640349 missense probably benign 0.01
IGL01861:Dnah7a APN 1 53584449 splice site probably benign
IGL01984:Dnah7a APN 1 53702015 splice site probably null
IGL02056:Dnah7a APN 1 53504342 missense probably benign 0.17
IGL02069:Dnah7a APN 1 53561894 splice site probably benign
IGL02072:Dnah7a APN 1 53605827 missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53411580 missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53495717 missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53437513 missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53623473 missense probably benign 0.01
IGL02151:Dnah7a APN 1 53472864 missense probably benign 0.08
IGL02156:Dnah7a APN 1 53419723 missense probably benign 0.27
IGL02270:Dnah7a APN 1 53472893 missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53643510 missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53524937 critical splice donor site probably null
IGL02370:Dnah7a APN 1 53635397 missense probably benign 0.00
IGL02420:Dnah7a APN 1 53686543 missense probably benign
IGL02458:Dnah7a APN 1 53618328 nonsense probably null
IGL02489:Dnah7a APN 1 53647322 missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53618046 missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53432915 missense probably benign 0.00
IGL02646:Dnah7a APN 1 53525035 missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53504024 missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53444472 missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53472959 splice site probably benign
IGL02874:Dnah7a APN 1 53605814 missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53522360 missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53577328 missense probably benign 0.27
IGL02926:Dnah7a APN 1 53495950 missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53433004 missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53605824 missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53419607 missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53686614 splice site probably benign
IGL03214:Dnah7a APN 1 53522209 critical splice donor site probably null
IGL03242:Dnah7a APN 1 53620723 missense probably benign 0.02
IGL03251:Dnah7a APN 1 53647274 missense probably benign
IGL03265:Dnah7a APN 1 53528848 missense probably benign
IGL03277:Dnah7a APN 1 53630322 missense probably benign 0.00
IGL03278:Dnah7a APN 1 53496965 missense probably benign 0.07
IGL03356:Dnah7a APN 1 53503934 missense probably benign 0.01
R0046:Dnah7a UTSW 1 53456874 splice site probably null
R0051:Dnah7a UTSW 1 53521086 splice site probably benign
R0082:Dnah7a UTSW 1 53518708 missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53468684 missense probably benign 0.03
R0122:Dnah7a UTSW 1 53397142 missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53501526 missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53504146 missense probably benign 0.00
R0309:Dnah7a UTSW 1 53405690 missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53433054 missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53504198 missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53605819 missense probably benign 0.00
R0511:Dnah7a UTSW 1 53497126 missense probably benign
R0576:Dnah7a UTSW 1 53636087 missense probably benign 0.12
R0592:Dnah7a UTSW 1 53456612 missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53497105 missense probably benign 0.18
R0689:Dnah7a UTSW 1 53620681 nonsense probably null
R0735:Dnah7a UTSW 1 53544511 missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53565696 missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53504079 missense probably benign 0.07
R0842:Dnah7a UTSW 1 53501674 missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53427860 missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53468669 missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53647236 splice site probably benign
R1421:Dnah7a UTSW 1 53540873 splice site probably benign
R1445:Dnah7a UTSW 1 53528797 missense probably benign 0.02
R1473:Dnah7a UTSW 1 53496014 missense probably benign 0.00
R1538:Dnah7a UTSW 1 53495989 missense possibly damaging 0.71
R1742:Dnah7a UTSW 1 53456684 missense probably benign 0.39
R1754:Dnah7a UTSW 1 53504185 missense probably benign 0.18
R1754:Dnah7a UTSW 1 53561900 critical splice donor site probably null
R1773:Dnah7a UTSW 1 53432887 splice site probably null
R1779:Dnah7a UTSW 1 53577223 missense probably benign
R1816:Dnah7a UTSW 1 53631742 splice site probably benign
R1817:Dnah7a UTSW 1 53559148 missense probably benign
R1818:Dnah7a UTSW 1 53559148 missense probably benign
R1819:Dnah7a UTSW 1 53559148 missense probably benign
R1873:Dnah7a UTSW 1 53456532 splice site probably benign
R1875:Dnah7a UTSW 1 53456532 splice site probably benign
R1884:Dnah7a UTSW 1 53541000 missense probably damaging 0.99
R1902:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1903:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53631562 missense probably benign
R1959:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1960:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1985:Dnah7a UTSW 1 53503934 missense probably benign 0.01
R1992:Dnah7a UTSW 1 53582676 missense possibly damaging 0.91
R2037:Dnah7a UTSW 1 53582582 missense probably benign 0.00
R2074:Dnah7a UTSW 1 53457696 missense probably benign 0.45
R2076:Dnah7a UTSW 1 53503809 missense probably benign 0.01
R2124:Dnah7a UTSW 1 53496942 missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53605875 missense possibly damaging 0.54
R2211:Dnah7a UTSW 1 53479773 missense probably benign 0.21
R2220:Dnah7a UTSW 1 53521174 missense probably benign
R2355:Dnah7a UTSW 1 53582502 missense probably benign 0.00
R2495:Dnah7a UTSW 1 53605881 missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53427872 missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53427824 critical splice donor site probably null
R2993:Dnah7a UTSW 1 53503554 missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53618116 missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53444516 missense probably benign
R3723:Dnah7a UTSW 1 53447346 missense probably benign 0.04
R3847:Dnah7a UTSW 1 53501656 missense probably benign 0.01
R4002:Dnah7a UTSW 1 53631681 missense probably benign
R4009:Dnah7a UTSW 1 53525005 missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53425217 missense probably benign
R4193:Dnah7a UTSW 1 53447334 missense probably benign 0.00
R4236:Dnah7a UTSW 1 53447365 missense probably benign 0.00
R4399:Dnah7a UTSW 1 53518727 missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53444526 missense probably benign 0.01
R4494:Dnah7a UTSW 1 53449038 missense probably benign 0.01
R4569:Dnah7a UTSW 1 53411659 missense probably benign 0.01
R4609:Dnah7a UTSW 1 53456657 missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53427951 missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53447317 critical splice donor site probably null
R4781:Dnah7a UTSW 1 53425208 missense probably benign 0.28
R4854:Dnah7a UTSW 1 53706729 utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53503578 missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53698692 missense probably benign
R5000:Dnah7a UTSW 1 53567042 missense probably damaging 1.00
R5026:Dnah7a UTSW 1 53662498 missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53497096 missense probably benign 0.01
R5119:Dnah7a UTSW 1 53698692 missense probably benign
R5151:Dnah7a UTSW 1 53620770 missense probably benign 0.00
R5155:Dnah7a UTSW 1 53643495 missense probably benign 0.01
R5180:Dnah7a UTSW 1 53423287 missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53437609 critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53447531 intron probably null
R5267:Dnah7a UTSW 1 53479692 missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53503646 missense probably benign 0.00
R5358:Dnah7a UTSW 1 53547172 missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53631653 missense probably benign 0.01
R5412:Dnah7a UTSW 1 53635344 missense probably benign
R5496:Dnah7a UTSW 1 53457768 missense probably benign
R5531:Dnah7a UTSW 1 53419748 missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53425253 missense probably benign
R5543:Dnah7a UTSW 1 53504069 missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53534452 missense probably benign 0.00
R5609:Dnah7a UTSW 1 53582594 missense probably benign 0.03
R5643:Dnah7a UTSW 1 53405707 missense probably benign
R5644:Dnah7a UTSW 1 53540979 missense probably benign 0.33
R5689:Dnah7a UTSW 1 53405698 missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53413778 missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53483319 missense probably benign 0.03
R5893:Dnah7a UTSW 1 53457785 missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53559308 missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53620670 missense probably benign 0.00
R6102:Dnah7a UTSW 1 53559140 missense probably benign 0.00
R6108:Dnah7a UTSW 1 53456845 missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53419655 missense probably benign 0.05
R6168:Dnah7a UTSW 1 53411568 missense probably damaging 1.00
R6175:Dnah7a UTSW 1 53433022 missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53419636 missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53503601 missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53541114 missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53397190 missense probably benign 0.02
R6530:Dnah7a UTSW 1 53503697 missense probably benign 0.04
R6574:Dnah7a UTSW 1 53456534 critical splice donor site probably null
R6608:Dnah7a UTSW 1 53525118 missense probably benign
R6625:Dnah7a UTSW 1 53565757 missense probably benign 0.05
R6661:Dnah7a UTSW 1 53623450 missense probably benign 0.00
R6681:Dnah7a UTSW 1 53521226 critical splice acceptor site probably null
R6747:Dnah7a UTSW 1 53636062 missense probably benign 0.01
R6774:Dnah7a UTSW 1 53698651 missense probably benign
R6823:Dnah7a UTSW 1 53456704 missense probably benign
R6900:Dnah7a UTSW 1 53662351 missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53631677 missense probably benign 0.09
R6956:Dnah7a UTSW 1 53577287 missense probably benign 0.02
R6978:Dnah7a UTSW 1 53662367 missense probably null
R6988:Dnah7a UTSW 1 53582625 missense possibly damaging 0.62
R7026:Dnah7a UTSW 1 53504289 missense probably benign
R7027:Dnah7a UTSW 1 53631506 missense probably benign 0.01
R7033:Dnah7a UTSW 1 53479661 missense probably damaging 1.00
R7072:Dnah7a UTSW 1 53419753 missense not run
R7096:Dnah7a UTSW 1 53483440 missense not run
R7142:Dnah7a UTSW 1 53413768 nonsense probably null
X0027:Dnah7a UTSW 1 53472930 missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53468643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAGCAAAGTCCCTGAAGAAAATA -3'
(R):5'- CCTCACAAAATTGTCTCATAAATGTAC -3'

Sequencing Primer
(F):5'- gagaaatgtatgcatatatGAGG -3'
(R):5'- TATGCAGCTAGAGTCCAGAGCTC -3'
Posted On2017-02-09