Incidental Mutation 'R5086:Syde2'
ID453533
Institutional Source Beutler Lab
Gene Symbol Syde2
Ensembl Gene ENSMUSG00000036863
Gene Namesynapse defective 1, Rho GTPase, homolog 2 (C. elegans)
SynonymsC430017H16Rik
MMRRC Submission 042675-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R5086 (G1)
Quality Score217
Status Validated
Chromosome3
Chromosomal Location145987870-146021720 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) CAGTT to CAGTTAGTT at 146001408 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039517] [ENSMUST00000200546] [ENSMUST00000212479]
Predicted Effect probably null
Transcript: ENSMUST00000039517
SMART Domains Protein: ENSMUSP00000041897
Gene: ENSMUSG00000036863

DomainStartEndE-ValueType
low complexity region 65 98 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
low complexity region 197 221 N/A INTRINSIC
low complexity region 623 636 N/A INTRINSIC
C2 802 902 1.1e0 SMART
RhoGAP 950 1149 1.23e-57 SMART
Blast:RhoGAP 1151 1299 2e-50 BLAST
low complexity region 1300 1311 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195918
Predicted Effect probably null
Transcript: ENSMUST00000200546
SMART Domains Protein: ENSMUSP00000142954
Gene: ENSMUSG00000036863

DomainStartEndE-ValueType
low complexity region 355 368 N/A INTRINSIC
C2 534 634 7.2e-3 SMART
RhoGAP 682 881 7.3e-60 SMART
Blast:RhoGAP 883 1031 2e-50 BLAST
low complexity region 1032 1043 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000212479
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl T A 15: 80,963,700 M278K probably damaging Het
Ago1 T C 4: 126,453,604 I147V probably benign Het
Ank1 T C 8: 23,088,618 L261P probably damaging Het
Ank2 T C 3: 126,947,348 probably benign Het
Ap1b1 T C 11: 5,018,020 V177A possibly damaging Het
Arhgap21 A G 2: 20,848,834 S1906P probably benign Het
Asb1 A G 1: 91,554,811 Y214C probably benign Het
BC049715 C T 6: 136,840,431 T223M probably damaging Het
C1ra T A 6: 124,519,729 C375S probably damaging Het
C530008M17Rik A G 5: 76,857,124 E444G unknown Het
Cdh26 C T 2: 178,441,417 R26* probably null Het
Chordc1 A G 9: 18,312,835 M304V probably benign Het
Cpne8 T C 15: 90,648,568 probably benign Het
Csf1 T C 3: 107,748,710 E335G possibly damaging Het
Ctnnd2 C T 15: 30,683,347 P498L possibly damaging Het
Cyp4f18 C T 8: 72,002,432 R100H probably benign Het
Dnaaf2 G A 12: 69,197,286 R334C probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dock10 A G 1: 80,551,472 S1071P possibly damaging Het
Dtnb T C 12: 3,632,942 V7A probably benign Het
Eif1 T C 11: 100,320,726 I62T probably damaging Het
Fbxo44 T A 4: 148,156,212 T145S probably benign Het
G530012D18Rik G C 1: 85,577,220 probably benign Het
Gabbr2 A T 4: 46,724,342 M17K probably damaging Het
Gm1966 A T 7: 106,598,027 noncoding transcript Het
Gm5860 T A 4: 82,065,936 noncoding transcript Het
Gm7964 T A 7: 83,757,352 F439Y possibly damaging Het
Gpbp1l1 C A 4: 116,588,592 T297N probably benign Het
Greb1 C T 12: 16,708,022 probably benign Het
Hkdc1 T C 10: 62,395,274 probably benign Het
Ighv16-1 T A 12: 114,068,890 L97F probably benign Het
Il21r A G 7: 125,632,855 D485G probably damaging Het
Inpp5d A G 1: 87,705,964 H441R probably damaging Het
Iqgap2 G T 13: 95,635,580 R1364S probably benign Het
Krtap20-2 G T 16: 89,205,918 C2F unknown Het
Man2c1 T A 9: 57,131,640 D111E probably damaging Het
Map1a G A 2: 121,304,504 E1696K probably damaging Het
Mdc1 T A 17: 35,848,630 V634E probably benign Het
Mgam2-ps A G 6: 40,823,613 noncoding transcript Het
Mllt3 T A 4: 87,789,298 N68Y probably damaging Het
Mrps18a T A 17: 46,125,695 D143E probably benign Het
Myl12a T C 17: 70,994,616 D172G possibly damaging Het
Notch3 T C 17: 32,143,334 N1439S probably benign Het
Npepps T C 11: 97,217,799 M764V probably benign Het
Olfr926 T C 9: 38,877,791 L205P probably damaging Het
Paxbp1 A T 16: 91,015,216 probably benign Het
Pcdhb7 A T 18: 37,343,109 T433S possibly damaging Het
Pcdhb8 A T 18: 37,356,106 Y279F probably damaging Het
Pim3 T C 15: 88,864,403 L235P probably damaging Het
Plekha4 C T 7: 45,553,658 S685F possibly damaging Het
Plekhg1 C A 10: 3,903,649 H167Q probably damaging Het
Plekhn1 G C 4: 156,222,424 P503A probably benign Het
Sar1a T C 10: 61,691,346 L181P probably damaging Het
Sec22a G T 16: 35,347,742 S133* probably null Het
Sipa1l3 G A 7: 29,348,575 S247F probably damaging Het
Slc31a1 T C 4: 62,387,953 S103P probably damaging Het
Spag6 A C 2: 18,742,877 probably benign Het
Stab1 T A 14: 31,143,624 D1769V probably damaging Het
Stab1 G A 14: 31,159,304 L590F probably damaging Het
Tbc1d2b A G 9: 90,227,457 L322P probably benign Het
Tdrp T C 8: 13,974,590 E18G possibly damaging Het
Tlr3 T A 8: 45,402,825 N106I probably damaging Het
Tmem104 T A 11: 115,201,401 I112N probably damaging Het
Tmem14c C T 13: 41,021,122 T69I probably benign Het
Tmprss11g G A 5: 86,496,518 P156S possibly damaging Het
Ttn A T 2: 76,870,603 probably benign Het
Vmn1r45 A T 6: 89,933,100 I296N probably benign Het
Vmn2r1 T A 3: 64,089,997 V358D probably benign Het
Zc3h7b T C 15: 81,793,174 L892P probably damaging Het
Zfp366 A G 13: 99,228,943 Q204R probably benign Het
Zfp598 C A 17: 24,680,898 probably benign Het
Other mutations in Syde2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Syde2 APN 3 146014341 missense possibly damaging 0.76
IGL01624:Syde2 APN 3 146007035 missense probably damaging 1.00
IGL02059:Syde2 APN 3 146002172 missense possibly damaging 0.77
IGL02195:Syde2 APN 3 146002156 missense probably damaging 1.00
IGL02498:Syde2 APN 3 145998689 missense probably benign 0.08
IGL02609:Syde2 APN 3 145998520 missense probably benign 0.00
IGL02721:Syde2 APN 3 146002004 missense probably damaging 1.00
IGL02932:Syde2 APN 3 146001476 missense possibly damaging 0.79
IGL02957:Syde2 APN 3 145989179 splice site probably benign
R0062:Syde2 UTSW 3 145998753 missense probably benign 0.00
R0062:Syde2 UTSW 3 145998753 missense probably benign 0.00
R0413:Syde2 UTSW 3 146007132 missense probably damaging 1.00
R0505:Syde2 UTSW 3 146014380 missense possibly damaging 0.85
R0535:Syde2 UTSW 3 145989170 critical splice donor site probably null
R0646:Syde2 UTSW 3 146014249 splice site probably null
R1535:Syde2 UTSW 3 146002421 splice site probably benign
R1914:Syde2 UTSW 3 146014316 nonsense probably null
R1915:Syde2 UTSW 3 146014316 nonsense probably null
R1997:Syde2 UTSW 3 145998991 missense probably benign 0.08
R2012:Syde2 UTSW 3 145988408 missense possibly damaging 0.88
R2112:Syde2 UTSW 3 145998486 missense possibly damaging 0.52
R2220:Syde2 UTSW 3 146001958 missense probably benign 0.07
R2990:Syde2 UTSW 3 146001497 missense probably damaging 0.97
R4022:Syde2 UTSW 3 146015725 missense probably benign 0.25
R5077:Syde2 UTSW 3 146002009 missense probably damaging 1.00
R5084:Syde2 UTSW 3 146001409 frame shift probably null
R5084:Syde2 UTSW 3 146001408 nonsense probably null
R5087:Syde2 UTSW 3 146007126 missense probably damaging 1.00
R5087:Syde2 UTSW 3 146001408 nonsense probably null
R5101:Syde2 UTSW 3 146015638 missense probably damaging 1.00
R5211:Syde2 UTSW 3 146001338 missense probably benign 0.01
R5842:Syde2 UTSW 3 145999020 missense probably benign 0.00
R6025:Syde2 UTSW 3 146007141 splice site probably null
R6352:Syde2 UTSW 3 145998474 nonsense probably null
R6384:Syde2 UTSW 3 145998813 missense probably damaging 1.00
R6769:Syde2 UTSW 3 145999048 missense probably damaging 0.98
R6771:Syde2 UTSW 3 145999048 missense probably damaging 0.98
R6970:Syde2 UTSW 3 145988626 missense probably benign 0.15
R6988:Syde2 UTSW 3 146019809 missense probably benign 0.31
R7067:Syde2 UTSW 3 145988264 missense probably benign 0.00
R7146:Syde2 UTSW 3 146007115 nonsense probably null
R7191:Syde2 UTSW 3 146002358 missense probably benign 0.04
R7246:Syde2 UTSW 3 145988755 missense probably benign 0.22
R7271:Syde2 UTSW 3 146020276 missense possibly damaging 0.71
R7307:Syde2 UTSW 3 146015798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCGTCTCTGTGCTGAGAG -3'
(R):5'- ACACCCTGAGGAATTTCTCGAC -3'

Sequencing Primer
(F):5'- TCTCTGTGCTGAGAGCCGAG -3'
(R):5'- TGAGGAATTTCTCGACAGTTCC -3'
Posted On2017-02-09