Incidental Mutation 'R5847:Olfr1097'
ID453654
Institutional Source Beutler Lab
Gene Symbol Olfr1097
Ensembl Gene ENSMUSG00000075170
Gene Nameolfactory receptor 1097
SynonymsMOR206-2, GA_x6K02T2Q125-48376288-48375341
MMRRC Submission 044065-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5847 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86886773-86892216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86890332 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 281 (V281G)
Ref Sequence ENSEMBL: ENSMUSP00000150400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111576] [ENSMUST00000217403]
Predicted Effect probably damaging
Transcript: ENSMUST00000111576
AA Change: V281G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107202
Gene: ENSMUSG00000075170
AA Change: V281G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8e-52 PFAM
Pfam:7tm_1 41 312 4.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217403
AA Change: V281G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.332 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,933,478 F701L probably damaging Het
4931409K22Rik A T 5: 24,544,166 L778Q probably benign Het
Adgrg6 T A 10: 14,426,777 Y964F probably damaging Het
Akap3 T A 6: 126,865,558 L380Q probably damaging Het
Alpk1 A G 3: 127,680,074 I760T probably benign Het
Arhgap20 G A 9: 51,824,976 probably benign Het
Cacng3 T C 7: 122,762,309 F113S possibly damaging Het
Ccdc158 G T 5: 92,627,480 N955K probably benign Het
Ccdc63 T A 5: 122,116,845 M368L possibly damaging Het
Cnot2 T C 10: 116,527,946 T18A probably damaging Het
Ctnna2 A T 6: 76,973,837 D550E possibly damaging Het
Cyp2c37 C T 19: 40,011,732 R433W probably damaging Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dek A G 13: 47,101,601 probably benign Het
Dnah9 CAGTTGCTTAAA CA 11: 66,095,240 probably null Het
Dock4 A G 12: 40,621,251 Y23C probably damaging Het
Edar T A 10: 58,603,179 S344C probably damaging Het
Epg5 T C 18: 78,030,055 V2431A probably benign Het
Evc2 C T 5: 37,404,724 probably benign Het
Idh3b A T 2: 130,284,028 D41E probably benign Het
Igkv8-24 A T 6: 70,216,972 V84D probably damaging Het
Mgam T C 6: 40,684,055 I1118T probably benign Het
Mtmr3 A G 11: 4,482,925 V1116A probably damaging Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ncr1 A T 7: 4,344,574 D246V probably benign Het
Nphp3 A G 9: 104,003,037 E86G probably damaging Het
Olfr168 A T 16: 19,530,326 V198E probably damaging Het
Olfr678 A T 7: 105,069,857 Y130F probably benign Het
Pbld1 A T 10: 63,076,414 I275L probably benign Het
Pde12 A G 14: 26,665,631 V574A possibly damaging Het
Pdxk G T 10: 78,445,038 D189E probably benign Het
Pkhd1 C A 1: 20,374,736 E2276* probably null Het
Ppp1r10 A G 17: 35,926,847 N237S possibly damaging Het
Rheb T A 5: 24,807,069 Y131F probably benign Het
Rpgrip1l T C 8: 91,304,985 D88G probably damaging Het
Scgb2b33 T C 7: 33,112,814 noncoding transcript Het
Snx9 C A 17: 5,924,621 N461K possibly damaging Het
Tbc1d2b C A 9: 90,209,724 V842F probably damaging Het
Tgfbi G A 13: 56,636,605 E615K possibly damaging Het
Tmem51 A G 4: 142,032,035 M134T probably damaging Het
Tox4 A G 14: 52,286,784 D125G probably damaging Het
Trappc3 A T 4: 126,273,978 N110I probably damaging Het
Trim11 T A 11: 58,990,593 D437E probably damaging Het
Ttc23l T C 15: 10,537,596 N196S probably benign Het
Wnk1 C A 6: 119,992,408 G362V probably damaging Het
Wwc1 A G 11: 35,867,326 F731S probably damaging Het
Wwp1 A T 4: 19,662,174 D140E possibly damaging Het
Zfp24 G A 18: 24,018,038 P17L possibly damaging Het
Zfp354b T C 11: 50,923,216 E294G probably damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zfp868 T C 8: 69,611,652 H344R probably damaging Het
Other mutations in Olfr1097
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Olfr1097 APN 2 86890245 missense probably benign
IGL01674:Olfr1097 APN 2 86890749 missense probably benign
IGL02089:Olfr1097 APN 2 86891116 missense possibly damaging 0.86
IGL02201:Olfr1097 APN 2 86891076 missense probably damaging 0.97
IGL02426:Olfr1097 APN 2 86890620 missense probably damaging 1.00
IGL02469:Olfr1097 APN 2 86891155 missense possibly damaging 0.91
IGL02489:Olfr1097 APN 2 86890995 missense probably damaging 1.00
IGL02817:Olfr1097 APN 2 86890593 missense probably benign
R0042:Olfr1097 UTSW 2 86890491 missense probably damaging 1.00
R0605:Olfr1097 UTSW 2 86890419 missense possibly damaging 0.65
R1867:Olfr1097 UTSW 2 86890612 missense probably damaging 0.98
R2412:Olfr1097 UTSW 2 86890834 missense probably benign 0.01
R4465:Olfr1097 UTSW 2 86891150 missense probably benign
R4520:Olfr1097 UTSW 2 86891019 missense probably benign 0.20
R5185:Olfr1097 UTSW 2 86890602 missense probably benign 0.42
R5329:Olfr1097 UTSW 2 86890620 missense probably damaging 1.00
R5496:Olfr1097 UTSW 2 86890314 missense probably damaging 1.00
R5496:Olfr1097 UTSW 2 86890315 missense probably damaging 1.00
R6288:Olfr1097 UTSW 2 86890882 missense probably benign 0.01
R6906:Olfr1097 UTSW 2 86890747 missense probably benign
R7161:Olfr1097 UTSW 2 86890649 missense probably benign 0.01
R7256:Olfr1097 UTSW 2 86890612 missense probably damaging 0.98
R7404:Olfr1097 UTSW 2 86890873 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACAAGTCTGTCAGTTTTGTGCC -3'
(R):5'- TGTCGCTCATCACGATATCC -3'

Sequencing Primer
(F):5'- CTGTCAGTTTTGTGCCAAGAGAGAAG -3'
(R):5'- GCTCATCACGATATCCTCATCCTATG -3'
Posted On2017-02-10