Incidental Mutation 'R5847:Akap3'
ID453672
Institutional Source Beutler Lab
Gene Symbol Akap3
Ensembl Gene ENSMUSG00000030344
Gene NameA kinase (PRKA) anchor protein 3
SynonymsAkap110; Sob1; Fsp95
MMRRC Submission 044065-MU
Accession Numbers

NCBI RefSeq: NM_009650.2; MGI:1341149

Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5847 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location126853098-126874308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126865558 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 380 (L380Q)
Ref Sequence ENSEMBL: ENSMUSP00000143794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095440] [ENSMUST00000202574] [ENSMUST00000202878]
Predicted Effect probably damaging
Transcript: ENSMUST00000095440
AA Change: L380Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093091
Gene: ENSMUSG00000030344
AA Change: L380Q

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202574
AA Change: L380Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144405
Gene: ENSMUSG00000030344
AA Change: L380Q

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000202878
AA Change: L380Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143794
Gene: ENSMUSG00000030344
AA Change: L380Q

DomainStartEndE-ValueType
AKAP_110 5 864 N/A SMART
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of A-kinase anchoring proteins (AKAPs), a family of functionally related proteins that target protein kinase A to discrete locations within the cell. The encoded protein is reported to participate in protein-protein interactions with the R-subunit of the protein kinase A as well as sperm-associated proteins. This protein is expressed in spermatozoa and localized to the acrosomal region of the sperm head as well as the length of the principal piece. It may function as a regulator of motility, capacitation, and the acrosome reaction. [provided by RefSeq, May 2013]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,933,478 F701L probably damaging Het
4931409K22Rik A T 5: 24,544,166 L778Q probably benign Het
Adgrg6 T A 10: 14,426,777 Y964F probably damaging Het
Alpk1 A G 3: 127,680,074 I760T probably benign Het
Arhgap20 G A 9: 51,824,976 probably benign Het
Cacng3 T C 7: 122,762,309 F113S possibly damaging Het
Ccdc158 G T 5: 92,627,480 N955K probably benign Het
Ccdc63 T A 5: 122,116,845 M368L possibly damaging Het
Cnot2 T C 10: 116,527,946 T18A probably damaging Het
Ctnna2 A T 6: 76,973,837 D550E possibly damaging Het
Cyp2c37 C T 19: 40,011,732 R433W probably damaging Het
Dact2 A G 17: 14,199,188 S103P probably damaging Het
Dek A G 13: 47,101,601 probably benign Het
Dnah9 CAGTTGCTTAAA CA 11: 66,095,240 probably null Het
Dock4 A G 12: 40,621,251 Y23C probably damaging Het
Edar T A 10: 58,603,179 S344C probably damaging Het
Epg5 T C 18: 78,030,055 V2431A probably benign Het
Evc2 C T 5: 37,404,724 probably benign Het
Idh3b A T 2: 130,284,028 D41E probably benign Het
Igkv8-24 A T 6: 70,216,972 V84D probably damaging Het
Mgam T C 6: 40,684,055 I1118T probably benign Het
Mtmr3 A G 11: 4,482,925 V1116A probably damaging Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ncr1 A T 7: 4,344,574 D246V probably benign Het
Nphp3 A G 9: 104,003,037 E86G probably damaging Het
Olfr1097 A C 2: 86,890,332 V281G probably damaging Het
Olfr168 A T 16: 19,530,326 V198E probably damaging Het
Olfr678 A T 7: 105,069,857 Y130F probably benign Het
Pbld1 A T 10: 63,076,414 I275L probably benign Het
Pde12 A G 14: 26,665,631 V574A possibly damaging Het
Pdxk G T 10: 78,445,038 D189E probably benign Het
Pkhd1 C A 1: 20,374,736 E2276* probably null Het
Ppp1r10 A G 17: 35,926,847 N237S possibly damaging Het
Rheb T A 5: 24,807,069 Y131F probably benign Het
Rpgrip1l T C 8: 91,304,985 D88G probably damaging Het
Scgb2b33 T C 7: 33,112,814 noncoding transcript Het
Snx9 C A 17: 5,924,621 N461K possibly damaging Het
Tbc1d2b C A 9: 90,209,724 V842F probably damaging Het
Tgfbi G A 13: 56,636,605 E615K possibly damaging Het
Tmem51 A G 4: 142,032,035 M134T probably damaging Het
Tox4 A G 14: 52,286,784 D125G probably damaging Het
Trappc3 A T 4: 126,273,978 N110I probably damaging Het
Trim11 T A 11: 58,990,593 D437E probably damaging Het
Ttc23l T C 15: 10,537,596 N196S probably benign Het
Wnk1 C A 6: 119,992,408 G362V probably damaging Het
Wwc1 A G 11: 35,867,326 F731S probably damaging Het
Wwp1 A T 4: 19,662,174 D140E possibly damaging Het
Zfp24 G A 18: 24,018,038 P17L possibly damaging Het
Zfp354b T C 11: 50,923,216 E294G probably damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zfp868 T C 8: 69,611,652 H344R probably damaging Het
Other mutations in Akap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Akap3 APN 6 126865731 missense probably benign 0.38
IGL01070:Akap3 APN 6 126865879 missense possibly damaging 0.93
IGL01975:Akap3 APN 6 126874000 missense probably damaging 1.00
IGL02114:Akap3 APN 6 126865996 missense probably damaging 0.99
IGL02349:Akap3 APN 6 126860263 missense probably benign 0.01
IGL03305:Akap3 APN 6 126864765 missense probably benign
IGL03412:Akap3 APN 6 126864725 missense probably benign 0.00
IGL03097:Akap3 UTSW 6 126866416 missense probably damaging 1.00
P0012:Akap3 UTSW 6 126864601 missense possibly damaging 0.87
R0358:Akap3 UTSW 6 126866812 missense probably damaging 1.00
R1123:Akap3 UTSW 6 126865966 missense probably benign 0.27
R1163:Akap3 UTSW 6 126864787 missense probably damaging 1.00
R1458:Akap3 UTSW 6 126865554 missense probably damaging 1.00
R1769:Akap3 UTSW 6 126865846 missense possibly damaging 0.67
R1967:Akap3 UTSW 6 126865098 missense probably benign 0.02
R4030:Akap3 UTSW 6 126865021 missense probably damaging 1.00
R4618:Akap3 UTSW 6 126866443 missense probably benign 0.31
R4677:Akap3 UTSW 6 126865263 missense probably damaging 0.99
R4735:Akap3 UTSW 6 126865638 missense probably damaging 1.00
R5660:Akap3 UTSW 6 126865291 missense probably damaging 1.00
R5834:Akap3 UTSW 6 126865833 missense probably benign 0.04
R6053:Akap3 UTSW 6 126866533 missense probably damaging 0.98
R7007:Akap3 UTSW 6 126866476 missense probably damaging 0.99
R7070:Akap3 UTSW 6 126874024 missense probably damaging 1.00
R7123:Akap3 UTSW 6 126866304 missense probably benign 0.05
R7173:Akap3 UTSW 6 126864766 missense probably benign
R7238:Akap3 UTSW 6 126865237 missense probably benign 0.00
R7437:Akap3 UTSW 6 126865655 missense probably damaging 1.00
X0028:Akap3 UTSW 6 126865917 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTGAAGAAGGTGCTGATG -3'
(R):5'- AGTTTCGGCACACGTCTTC -3'

Sequencing Primer
(F):5'- GAAGCACGCAAAGGAGGTTGTC -3'
(R):5'- GGCACACGTCTTCTCTTTCTCTAG -3'
Posted On2017-02-10