Incidental Mutation 'R5847:Dact2'
ID453699
Institutional Source Beutler Lab
Gene Symbol Dact2
Ensembl Gene ENSMUSG00000048826
Gene Namedishevelled-binding antagonist of beta-catenin 2
Synonymsdapper2, Dpr2, Frd2, 2900084M21Rik
MMRRC Submission 044065-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5847 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location14195231-14203831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14199188 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 103 (S103P)
Ref Sequence ENSEMBL: ENSMUSP00000051638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053218]
Predicted Effect probably damaging
Transcript: ENSMUST00000053218
AA Change: S103P

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051638
Gene: ENSMUSG00000048826
AA Change: S103P

DomainStartEndE-ValueType
Pfam:Dapper 19 757 1.8e-231 PFAM
Meta Mutation Damage Score 0.0312 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (62/62)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele develop normally but display enhanced keratinocyte migration and accelerated re-epithelialization during cutaneous wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,933,478 F701L probably damaging Het
4931409K22Rik A T 5: 24,544,166 L778Q probably benign Het
Adgrg6 T A 10: 14,426,777 Y964F probably damaging Het
Akap3 T A 6: 126,865,558 L380Q probably damaging Het
Alpk1 A G 3: 127,680,074 I760T probably benign Het
Arhgap20 G A 9: 51,824,976 probably benign Het
Cacng3 T C 7: 122,762,309 F113S possibly damaging Het
Ccdc158 G T 5: 92,627,480 N955K probably benign Het
Ccdc63 T A 5: 122,116,845 M368L possibly damaging Het
Cnot2 T C 10: 116,527,946 T18A probably damaging Het
Ctnna2 A T 6: 76,973,837 D550E possibly damaging Het
Cyp2c37 C T 19: 40,011,732 R433W probably damaging Het
Dek A G 13: 47,101,601 probably benign Het
Dnah9 CAGTTGCTTAAA CA 11: 66,095,240 probably null Het
Dock4 A G 12: 40,621,251 Y23C probably damaging Het
Edar T A 10: 58,603,179 S344C probably damaging Het
Epg5 T C 18: 78,030,055 V2431A probably benign Het
Evc2 C T 5: 37,404,724 probably benign Het
Idh3b A T 2: 130,284,028 D41E probably benign Het
Igkv8-24 A T 6: 70,216,972 V84D probably damaging Het
Mgam T C 6: 40,684,055 I1118T probably benign Het
Mtmr3 A G 11: 4,482,925 V1116A probably damaging Het
Myoc A G 1: 162,639,367 Y35C probably damaging Het
Ncr1 A T 7: 4,344,574 D246V probably benign Het
Nphp3 A G 9: 104,003,037 E86G probably damaging Het
Olfr1097 A C 2: 86,890,332 V281G probably damaging Het
Olfr168 A T 16: 19,530,326 V198E probably damaging Het
Olfr678 A T 7: 105,069,857 Y130F probably benign Het
Pbld1 A T 10: 63,076,414 I275L probably benign Het
Pde12 A G 14: 26,665,631 V574A possibly damaging Het
Pdxk G T 10: 78,445,038 D189E probably benign Het
Pkhd1 C A 1: 20,374,736 E2276* probably null Het
Ppp1r10 A G 17: 35,926,847 N237S possibly damaging Het
Rheb T A 5: 24,807,069 Y131F probably benign Het
Rpgrip1l T C 8: 91,304,985 D88G probably damaging Het
Scgb2b33 T C 7: 33,112,814 noncoding transcript Het
Snx9 C A 17: 5,924,621 N461K possibly damaging Het
Tbc1d2b C A 9: 90,209,724 V842F probably damaging Het
Tgfbi G A 13: 56,636,605 E615K possibly damaging Het
Tmem51 A G 4: 142,032,035 M134T probably damaging Het
Tox4 A G 14: 52,286,784 D125G probably damaging Het
Trappc3 A T 4: 126,273,978 N110I probably damaging Het
Trim11 T A 11: 58,990,593 D437E probably damaging Het
Ttc23l T C 15: 10,537,596 N196S probably benign Het
Wnk1 C A 6: 119,992,408 G362V probably damaging Het
Wwc1 A G 11: 35,867,326 F731S probably damaging Het
Wwp1 A T 4: 19,662,174 D140E possibly damaging Het
Zfp24 G A 18: 24,018,038 P17L possibly damaging Het
Zfp354b T C 11: 50,923,216 E294G probably damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zfp868 T C 8: 69,611,652 H344R probably damaging Het
Other mutations in Dact2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01867:Dact2 APN 17 14195670 missense probably damaging 0.98
R0597:Dact2 UTSW 17 14197041 missense probably benign
R1657:Dact2 UTSW 17 14197990 missense probably benign 0.03
R1717:Dact2 UTSW 17 14197913 missense probably benign 0.11
R1734:Dact2 UTSW 17 14196639 missense probably benign 0.00
R1883:Dact2 UTSW 17 14197823 missense possibly damaging 0.81
R2238:Dact2 UTSW 17 14197050 missense probably damaging 0.99
R2878:Dact2 UTSW 17 14195914 missense probably damaging 1.00
R4290:Dact2 UTSW 17 14196571 missense probably benign 0.00
R4291:Dact2 UTSW 17 14196571 missense probably benign 0.00
R4902:Dact2 UTSW 17 14196729 missense possibly damaging 0.91
R5029:Dact2 UTSW 17 14195852 missense probably benign 0.00
R5084:Dact2 UTSW 17 14197952 missense possibly damaging 0.94
R5436:Dact2 UTSW 17 14195748 missense probably damaging 1.00
R5837:Dact2 UTSW 17 14196253 missense probably damaging 1.00
R6048:Dact2 UTSW 17 14197305 missense probably damaging 1.00
R6377:Dact2 UTSW 17 14199188 missense probably damaging 0.97
R7013:Dact2 UTSW 17 14203534 missense probably benign
R7268:Dact2 UTSW 17 14196535 missense probably benign 0.01
R7425:Dact2 UTSW 17 14196331 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGAAGCTGTCACTATTCC -3'
(R):5'- GCAGATGACAGTTAGGTGTGC -3'

Sequencing Primer
(F):5'- GGCTGAAGCTGTCACTATTCCTAATG -3'
(R):5'- GGTGTTTGTGATAGCTCTCTTTCACC -3'
Posted On2017-02-10