Mutagenetix > Incidental Mutation

Incidental Mutation 'R5848:Thsd7a'

453713

Institutional Source

Beutler Lab

Gene Symbol

Thsd7a

Ensembl Gene

ENSMUSG00000032625

Gene Name

thrombospondin, type I, domain containing 7A

Synonyms

LOC330267

MMRRC Submission

043225-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5848 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12311607-12749252 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12503922 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 411 (C411S)

Ref Sequence

ENSEMBL: ENSMUSP00000113681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119443

SMART Domains

Protein: ENSMUSP00000113780
Gene: ENSMUSG00000032625

Domain	Start	End	E-Value	Type
TSP1	14	70	9.98e-5	SMART
TSP1	77	161	3.14e0	SMART
TSP1	166	225	6.62e-1	SMART
Blast:TSP1	226	262	1e-8	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000119581
AA Change: C411S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: C411S

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1082	9.09e-8	SMART
TSP1	1085	1150	5.82e-1	SMART
TSP1	1155	1207	4.24e-2	SMART
TSP1	1210	1271	1e0	SMART
TSP1	1276	1328	3.55e-10	SMART
TSP1	1329	1399	7.5e-2	SMART
TSP1	1404	1462	1.55e-1	SMART
transmembrane domain	1594	1616	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172356
AA Change: C411S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: C411S

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1084	1.95e-7	SMART
TSP1	1087	1152	5.82e-1	SMART
TSP1	1157	1209	4.24e-2	SMART
TSP1	1212	1273	1e0	SMART
TSP1	1278	1330	3.55e-10	SMART
TSP1	1331	1401	7.5e-2	SMART
TSP1	1406	1464	1.55e-1	SMART
transmembrane domain	1596	1618	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,786,596 (GRCm39)	I7M	unknown	Het
Aadacl4	T	A	4: 144,344,428 (GRCm39)	M68K	probably benign	Het
Abca8b	C	A	11: 109,868,639 (GRCm39)	G175V	probably damaging	Het
Cdcp1	T	A	9: 123,012,770 (GRCm39)	H259L	possibly damaging	Het
Ckap4	T	C	10: 84,369,354 (GRCm39)	Q126R	probably benign	Het
Clec18a	C	T	8: 111,802,093 (GRCm39)	V299I	probably benign	Het
D7Ertd443e	A	G	7: 133,951,451 (GRCm39)	I27T	possibly damaging	Het
Dlg2	T	G	7: 92,093,735 (GRCm39)	D726E	probably benign	Het
Dnah8	T	C	17: 30,947,165 (GRCm39)	I1856T	possibly damaging	Het
Espl1	G	A	15: 102,231,011 (GRCm39)	V1837I	probably benign	Het
Fanca	G	T	8: 124,021,792 (GRCm39)		probably benign	Het
Fer1l5	A	G	1: 36,428,016 (GRCm39)	T437A	probably benign	Het
Gm10644	C	A	8: 84,660,668 (GRCm39)		probably benign	Het
Katnb1	A	G	8: 95,825,340 (GRCm39)	S635G	probably benign	Het
Map3k12	A	G	15: 102,412,670 (GRCm39)	V234A	possibly damaging	Het
Mks1	A	G	11: 87,747,696 (GRCm39)	N193S	probably benign	Het
Mmp11	T	C	10: 75,763,223 (GRCm39)	E151G	probably damaging	Het
Napg	A	G	18: 63,127,440 (GRCm39)	R265G	possibly damaging	Het
Odad2	T	A	18: 7,268,507 (GRCm39)		probably null	Het
Or5e1	T	A	7: 108,354,781 (GRCm39)	C239*	probably null	Het
Or6e1	A	G	14: 54,520,022 (GRCm39)	F110S	possibly damaging	Het
P3r3urf	T	C	4: 116,030,812 (GRCm39)	I72T	probably damaging	Het
Pcdha7	G	T	18: 37,108,136 (GRCm39)	C387F	probably damaging	Het
Pcdhb3	G	T	18: 37,434,700 (GRCm39)	R222L	probably benign	Het
Phf2	A	G	13: 48,973,546 (GRCm39)	M373T	unknown	Het
Plekha7	T	C	7: 115,739,634 (GRCm39)	T636A	probably damaging	Het
Rictor	G	A	15: 6,823,487 (GRCm39)	E1555K	probably benign	Het
Rnf6	G	A	5: 146,147,959 (GRCm39)	P353L	probably benign	Het
Sel1l3	A	C	5: 53,342,150 (GRCm39)	L357V	possibly damaging	Het
Sh3rf3	T	A	10: 58,819,975 (GRCm39)	M262K	possibly damaging	Het
Sorcs3	A	T	19: 48,776,950 (GRCm39)	H994L	probably damaging	Het
Ttn	T	C	2: 76,593,682 (GRCm39)	K20653E	probably damaging	Het
Ttn	A	C	2: 76,708,908 (GRCm39)		probably null	Het
Ttn	A	G	2: 76,611,264 (GRCm39)	W15677R	probably damaging	Het
Ubr2	T	C	17: 47,267,581 (GRCm39)	M1049V	possibly damaging	Het

Other mutations in Thsd7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Thsd7a	APN	6	12,379,658 (GRCm39)	splice site	probably null
IGL00563:Thsd7a	APN	6	12,379,658 (GRCm39)	splice site	probably null
IGL00753:Thsd7a	APN	6	12,327,528 (GRCm39)	missense	probably damaging	1.00
IGL00835:Thsd7a	APN	6	12,554,933 (GRCm39)	missense	probably damaging	1.00
IGL01486:Thsd7a	APN	6	12,471,079 (GRCm39)	missense	probably damaging	1.00
IGL01730:Thsd7a	APN	6	12,554,980 (GRCm39)	missense	probably benign	0.05
IGL01931:Thsd7a	APN	6	12,504,098 (GRCm39)	missense	probably damaging	1.00
IGL01935:Thsd7a	APN	6	12,317,418 (GRCm39)	missense	probably damaging	1.00
IGL01978:Thsd7a	APN	6	12,331,005 (GRCm39)	missense	probably benign	0.01
IGL02233:Thsd7a	APN	6	12,555,257 (GRCm39)	missense	probably benign	0.00
IGL02354:Thsd7a	APN	6	12,348,192 (GRCm39)	splice site	probably benign
IGL02361:Thsd7a	APN	6	12,348,192 (GRCm39)	splice site	probably benign
IGL02375:Thsd7a	APN	6	12,343,264 (GRCm39)	missense	probably damaging	1.00
IGL02468:Thsd7a	APN	6	12,318,170 (GRCm39)	missense	probably damaging	0.98
IGL02616:Thsd7a	APN	6	12,408,984 (GRCm39)	missense	probably damaging	0.98
IGL02820:Thsd7a	APN	6	12,321,071 (GRCm39)	missense	probably damaging	1.00
IGL02858:Thsd7a	APN	6	12,500,994 (GRCm39)	missense	probably benign	0.16
IGL03074:Thsd7a	APN	6	12,324,680 (GRCm39)	missense	probably damaging	0.99
IGL03234:Thsd7a	APN	6	12,343,177 (GRCm39)	missense	probably damaging	1.00
IGL03244:Thsd7a	APN	6	12,504,167 (GRCm39)	splice site	probably benign
IGL03337:Thsd7a	APN	6	12,405,173 (GRCm39)	missense	probably damaging	1.00
G1patch:Thsd7a	UTSW	6	12,555,630 (GRCm39)	missense	possibly damaging	0.87
PIT4354001:Thsd7a	UTSW	6	12,331,926 (GRCm39)	critical splice donor site	probably null
R0095:Thsd7a	UTSW	6	12,320,969 (GRCm39)	missense	probably damaging	0.99
R0127:Thsd7a	UTSW	6	12,554,907 (GRCm39)	missense	probably benign	0.01
R0142:Thsd7a	UTSW	6	12,418,334 (GRCm39)	missense	probably damaging	1.00
R0226:Thsd7a	UTSW	6	12,321,899 (GRCm39)	missense	possibly damaging	0.94
R0242:Thsd7a	UTSW	6	12,503,915 (GRCm39)	missense	probably benign	0.32
R0242:Thsd7a	UTSW	6	12,503,915 (GRCm39)	missense	probably benign	0.32
R0359:Thsd7a	UTSW	6	12,352,030 (GRCm39)	missense	probably damaging	1.00
R0365:Thsd7a	UTSW	6	12,321,886 (GRCm39)	critical splice donor site	probably null
R0504:Thsd7a	UTSW	6	12,379,593 (GRCm39)	missense	probably damaging	0.99
R0512:Thsd7a	UTSW	6	12,379,604 (GRCm39)	missense	possibly damaging	0.67
R0540:Thsd7a	UTSW	6	12,331,541 (GRCm39)	splice site	probably null
R0577:Thsd7a	UTSW	6	12,321,047 (GRCm39)	missense	possibly damaging	0.50
R0607:Thsd7a	UTSW	6	12,331,541 (GRCm39)	splice site	probably null
R0755:Thsd7a	UTSW	6	12,555,368 (GRCm39)	missense	probably damaging	1.00
R0771:Thsd7a	UTSW	6	12,327,576 (GRCm39)	missense	probably benign	0.09
R0780:Thsd7a	UTSW	6	12,337,273 (GRCm39)	missense	probably damaging	1.00
R0870:Thsd7a	UTSW	6	12,337,273 (GRCm39)	missense	probably damaging	1.00
R0871:Thsd7a	UTSW	6	12,337,273 (GRCm39)	missense	probably damaging	1.00
R0872:Thsd7a	UTSW	6	12,337,273 (GRCm39)	missense	probably damaging	1.00
R0873:Thsd7a	UTSW	6	12,337,273 (GRCm39)	missense	probably damaging	1.00
R1102:Thsd7a	UTSW	6	12,555,701 (GRCm39)	missense	possibly damaging	0.58
R1144:Thsd7a	UTSW	6	12,471,026 (GRCm39)	splice site	probably benign
R1265:Thsd7a	UTSW	6	12,317,418 (GRCm39)	missense	probably damaging	0.99
R1276:Thsd7a	UTSW	6	12,418,369 (GRCm39)	missense	probably damaging	1.00
R1381:Thsd7a	UTSW	6	12,555,438 (GRCm39)	missense	probably damaging	1.00
R1473:Thsd7a	UTSW	6	12,338,621 (GRCm39)	missense	probably benign	0.08
R1519:Thsd7a	UTSW	6	12,471,174 (GRCm39)	missense	probably benign	0.01
R1633:Thsd7a	UTSW	6	12,471,103 (GRCm39)	nonsense	probably null
R1659:Thsd7a	UTSW	6	12,504,063 (GRCm39)	missense	possibly damaging	0.73
R1769:Thsd7a	UTSW	6	12,555,714 (GRCm39)	nonsense	probably null
R1824:Thsd7a	UTSW	6	12,409,041 (GRCm39)	splice site	probably null
R1840:Thsd7a	UTSW	6	12,330,973 (GRCm39)	missense	probably benign	0.03
R1845:Thsd7a	UTSW	6	12,321,040 (GRCm39)	missense	probably damaging	1.00
R1874:Thsd7a	UTSW	6	12,555,434 (GRCm39)	missense	possibly damaging	0.76
R2023:Thsd7a	UTSW	6	12,327,535 (GRCm39)	missense	probably benign	0.16
R2039:Thsd7a	UTSW	6	12,408,922 (GRCm39)	missense	possibly damaging	0.77
R2058:Thsd7a	UTSW	6	12,318,105 (GRCm39)	splice site	probably benign
R2138:Thsd7a	UTSW	6	12,471,072 (GRCm39)	nonsense	probably null
R2155:Thsd7a	UTSW	6	12,379,632 (GRCm39)	missense	probably damaging	1.00
R2175:Thsd7a	UTSW	6	12,331,943 (GRCm39)	missense	possibly damaging	0.95
R2216:Thsd7a	UTSW	6	12,337,267 (GRCm39)	missense	possibly damaging	0.95
R2318:Thsd7a	UTSW	6	12,405,146 (GRCm39)	missense	probably damaging	1.00
R2375:Thsd7a	UTSW	6	12,337,361 (GRCm39)	missense	probably damaging	1.00
R3857:Thsd7a	UTSW	6	12,555,225 (GRCm39)	missense	probably benign	0.15
R3858:Thsd7a	UTSW	6	12,555,225 (GRCm39)	missense	probably benign	0.15
R3890:Thsd7a	UTSW	6	12,418,336 (GRCm39)	missense	probably benign	0.09
R3910:Thsd7a	UTSW	6	12,331,548 (GRCm39)	missense	probably damaging	0.96
R3933:Thsd7a	UTSW	6	12,555,225 (GRCm39)	missense	probably benign	0.15
R4369:Thsd7a	UTSW	6	12,468,907 (GRCm39)	missense	probably damaging	1.00
R4447:Thsd7a	UTSW	6	12,324,634 (GRCm39)	missense	probably damaging	0.98
R4664:Thsd7a	UTSW	6	12,504,012 (GRCm39)	missense	possibly damaging	0.90
R4664:Thsd7a	UTSW	6	12,337,313 (GRCm39)	missense	possibly damaging	0.79
R4665:Thsd7a	UTSW	6	12,504,012 (GRCm39)	missense	possibly damaging	0.90
R4665:Thsd7a	UTSW	6	12,337,313 (GRCm39)	missense	possibly damaging	0.79
R4666:Thsd7a	UTSW	6	12,504,012 (GRCm39)	missense	possibly damaging	0.90
R4666:Thsd7a	UTSW	6	12,337,313 (GRCm39)	missense	possibly damaging	0.79
R4668:Thsd7a	UTSW	6	12,408,967 (GRCm39)	missense	probably damaging	0.98
R4886:Thsd7a	UTSW	6	12,327,659 (GRCm39)	nonsense	probably null
R4918:Thsd7a	UTSW	6	12,327,558 (GRCm39)	missense	probably damaging	1.00
R4938:Thsd7a	UTSW	6	12,330,991 (GRCm39)	missense	probably benign	0.09
R5064:Thsd7a	UTSW	6	12,330,951 (GRCm39)	missense	possibly damaging	0.66
R5153:Thsd7a	UTSW	6	12,338,654 (GRCm39)	missense	probably benign	0.00
R5177:Thsd7a	UTSW	6	12,379,582 (GRCm39)	nonsense	probably null
R5242:Thsd7a	UTSW	6	12,327,582 (GRCm39)	missense	probably damaging	1.00
R5267:Thsd7a	UTSW	6	12,379,601 (GRCm39)	missense	probably damaging	1.00
R5442:Thsd7a	UTSW	6	12,748,799 (GRCm39)	missense	probably benign	0.00
R5506:Thsd7a	UTSW	6	12,332,016 (GRCm39)	missense	possibly damaging	0.85
R5525:Thsd7a	UTSW	6	12,332,006 (GRCm39)	missense	possibly damaging	0.52
R5544:Thsd7a	UTSW	6	12,379,470 (GRCm39)	missense	possibly damaging	0.94
R5651:Thsd7a	UTSW	6	12,343,212 (GRCm39)	missense	probably damaging	1.00
R5716:Thsd7a	UTSW	6	12,343,147 (GRCm39)	missense	probably benign	0.00
R5958:Thsd7a	UTSW	6	12,337,261 (GRCm39)	missense	probably benign	0.02
R6012:Thsd7a	UTSW	6	12,379,388 (GRCm39)	splice site	probably null
R6139:Thsd7a	UTSW	6	12,379,572 (GRCm39)	missense	possibly damaging	0.93
R6243:Thsd7a	UTSW	6	12,327,601 (GRCm39)	missense	probably damaging	1.00
R6257:Thsd7a	UTSW	6	12,408,987 (GRCm39)	nonsense	probably null
R6273:Thsd7a	UTSW	6	12,408,835 (GRCm39)	missense	probably damaging	0.99
R6300:Thsd7a	UTSW	6	12,471,103 (GRCm39)	nonsense	probably null
R6314:Thsd7a	UTSW	6	12,554,996 (GRCm39)	missense	possibly damaging	0.87
R6392:Thsd7a	UTSW	6	12,468,928 (GRCm39)	missense	probably damaging	0.99
R6418:Thsd7a	UTSW	6	12,555,081 (GRCm39)	nonsense	probably null
R6515:Thsd7a	UTSW	6	12,501,085 (GRCm39)	missense	possibly damaging	0.47
R6725:Thsd7a	UTSW	6	12,555,630 (GRCm39)	missense	possibly damaging	0.87
R6742:Thsd7a	UTSW	6	12,408,815 (GRCm39)	missense	probably damaging	1.00
R6776:Thsd7a	UTSW	6	12,555,636 (GRCm39)	missense	possibly damaging	0.53
R6838:Thsd7a	UTSW	6	12,504,074 (GRCm39)	missense	probably damaging	0.99
R7104:Thsd7a	UTSW	6	12,379,429 (GRCm39)	missense
R7170:Thsd7a	UTSW	6	12,352,090 (GRCm39)	missense
R7349:Thsd7a	UTSW	6	12,352,067 (GRCm39)	missense
R7460:Thsd7a	UTSW	6	12,554,933 (GRCm39)	missense
R7467:Thsd7a	UTSW	6	12,331,584 (GRCm39)	missense
R7666:Thsd7a	UTSW	6	12,379,437 (GRCm39)	missense
R7869:Thsd7a	UTSW	6	12,471,123 (GRCm39)	nonsense	probably null
R8032:Thsd7a	UTSW	6	12,555,287 (GRCm39)	missense
R8165:Thsd7a	UTSW	6	12,468,962 (GRCm39)	missense
R8167:Thsd7a	UTSW	6	12,317,400 (GRCm39)	nonsense	probably null
R8245:Thsd7a	UTSW	6	12,379,592 (GRCm39)	missense
R8310:Thsd7a	UTSW	6	12,396,612 (GRCm39)	missense
R8312:Thsd7a	UTSW	6	12,471,181 (GRCm39)	missense
R8331:Thsd7a	UTSW	6	12,471,157 (GRCm39)	missense
R8755:Thsd7a	UTSW	6	12,408,851 (GRCm39)	nonsense	probably null
R8843:Thsd7a	UTSW	6	12,501,136 (GRCm39)	missense
R8867:Thsd7a	UTSW	6	12,338,686 (GRCm39)	missense
R8952:Thsd7a	UTSW	6	12,468,992 (GRCm39)	missense	probably damaging	0.98
R9036:Thsd7a	UTSW	6	12,418,249 (GRCm39)	missense
R9299:Thsd7a	UTSW	6	12,504,131 (GRCm39)	missense
R9366:Thsd7a	UTSW	6	12,555,480 (GRCm39)	missense
R9489:Thsd7a	UTSW	6	12,352,022 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- TAAGCCTTCATGAAGATTTGGCC -3'
(R):5'- TGGTTGGAATGGAGCCCATG -3'

Sequencing Primer
(F):5'- CATGAAGATTTGGCCTGCAGC -3'
(R):5'- TTGGAATGGAGCCCATGTTCAAAAAC -3'

Posted On

2017-02-10