Incidental Mutation 'R5848:Olfr513'
ID453715
Institutional Source Beutler Lab
Gene Symbol Olfr513
Ensembl Gene ENSMUSG00000051200
Gene Nameolfactory receptor 513
SynonymsMOR195-1, GA_x6K02T2PBJ9-11084889-11085818
MMRRC Submission 043225-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R5848 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108750973-108756800 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 108755574 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 239 (C239*)
Ref Sequence ENSEMBL: ENSMUSP00000149440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055146] [ENSMUST00000214670]
Predicted Effect probably null
Transcript: ENSMUST00000055146
AA Change: C239*
SMART Domains Protein: ENSMUSP00000050578
Gene: ENSMUSG00000051200
AA Change: C239*

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 2.7e-55 PFAM
Pfam:7TM_GPCR_Srsx 33 304 2.3e-6 PFAM
Pfam:7tm_1 39 289 2.8e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214670
AA Change: C239*
Meta Mutation Damage Score 0.648 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik T C 4: 116,173,615 I72T probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Aadacl4 T A 4: 144,617,858 M68K probably benign Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Armc4 T A 18: 7,268,507 probably null Het
Cdcp1 T A 9: 123,183,705 H259L possibly damaging Het
Ckap4 T C 10: 84,533,490 Q126R probably benign Het
Clec18a C T 8: 111,075,461 V299I probably benign Het
D7Ertd443e A G 7: 134,349,722 I27T possibly damaging Het
Dlg2 T G 7: 92,444,527 D726E probably benign Het
Dnah8 T C 17: 30,728,191 I1856T possibly damaging Het
Espl1 G A 15: 102,322,576 V1837I probably benign Het
Fanca G T 8: 123,295,053 probably benign Het
Fer1l5 A G 1: 36,388,935 T437A probably benign Het
Gm10644 C A 8: 83,934,039 probably benign Het
Katnb1 A G 8: 95,098,712 S635G probably benign Het
Map3k12 A G 15: 102,504,235 V234A possibly damaging Het
Mks1 A G 11: 87,856,870 N193S probably benign Het
Mmp11 T C 10: 75,927,389 E151G probably damaging Het
Napg A G 18: 62,994,369 R265G possibly damaging Het
Olfr49 A G 14: 54,282,565 F110S possibly damaging Het
Pcdha7 G T 18: 36,975,083 C387F probably damaging Het
Pcdhb3 G T 18: 37,301,647 R222L probably benign Het
Phf2 A G 13: 48,820,070 M373T unknown Het
Plekha7 T C 7: 116,140,399 T636A probably damaging Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rnf6 G A 5: 146,211,149 P353L probably benign Het
Sel1l3 A C 5: 53,184,808 L357V possibly damaging Het
Sh3rf3 T A 10: 58,984,153 M262K possibly damaging Het
Sorcs3 A T 19: 48,788,511 H994L probably damaging Het
Thsd7a A T 6: 12,503,923 C411S probably damaging Het
Ttn T C 2: 76,763,338 K20653E probably damaging Het
Ttn A G 2: 76,780,920 W15677R probably damaging Het
Ttn A C 2: 76,878,564 probably null Het
Ubr2 T C 17: 46,956,655 M1049V possibly damaging Het
Other mutations in Olfr513
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Olfr513 APN 7 108755114 missense probably damaging 1.00
IGL03086:Olfr513 APN 7 108755796 utr 3 prime probably benign
FR4340:Olfr513 UTSW 7 108754954 small insertion probably benign
IGL02799:Olfr513 UTSW 7 108755623 missense probably benign
R0218:Olfr513 UTSW 7 108755574 nonsense probably null
R1103:Olfr513 UTSW 7 108754883 missense possibly damaging 0.92
R1251:Olfr513 UTSW 7 108754907 missense probably damaging 0.99
R1450:Olfr513 UTSW 7 108755512 missense probably damaging 1.00
R1582:Olfr513 UTSW 7 108755110 missense probably benign 0.04
R1608:Olfr513 UTSW 7 108755102 missense probably damaging 0.99
R1726:Olfr513 UTSW 7 108755008 missense probably benign 0.00
R1880:Olfr513 UTSW 7 108755128 missense probably damaging 1.00
R1881:Olfr513 UTSW 7 108755128 missense probably damaging 1.00
R2136:Olfr513 UTSW 7 108755223 missense possibly damaging 0.58
R2216:Olfr513 UTSW 7 108755612 missense probably damaging 1.00
R4006:Olfr513 UTSW 7 108755261 missense probably damaging 1.00
R4603:Olfr513 UTSW 7 108755627 missense probably damaging 1.00
R4881:Olfr513 UTSW 7 108755405 missense probably damaging 1.00
R5132:Olfr513 UTSW 7 108755270 missense probably damaging 1.00
R5426:Olfr513 UTSW 7 108755717 missense possibly damaging 0.94
R5679:Olfr513 UTSW 7 108754996 missense probably damaging 0.97
R5911:Olfr513 UTSW 7 108755675 missense probably benign 0.36
R6474:Olfr513 UTSW 7 108755029 missense probably damaging 1.00
R7016:Olfr513 UTSW 7 108755711 missense probably damaging 1.00
Z1088:Olfr513 UTSW 7 108755104 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACCACTTCTACTGTGCTGAC -3'
(R):5'- TGAAGTTTTGCCCTCCAGC -3'

Sequencing Primer
(F):5'- TCACTGGATCCCTCATGA -3'
(R):5'- TTCAGAGTATCCTTTACCTCTGTG -3'
Posted On2017-02-10