Incidental Mutation 'R5848:Armc4'
List |< first << previous [record 15 of 217] next >> last >|
ID453738
Institutional Source Beutler Lab
Gene Symbol Armc4
Ensembl Gene ENSMUSG00000061802
Gene Namearmadillo repeat containing 4
Synonymsb2b643Clo, 4930463I21Rik, b2b227.1Clo
MMRRC Submission 043225-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.605) question?
Stock #R5848 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location7088233-7297901 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) T to A at 7268507 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081275]
Predicted Effect probably null
Transcript: ENSMUST00000081275
SMART Domains Protein: ENSMUSP00000080028
Gene: ENSMUSG00000061802

DomainStartEndE-ValueType
low complexity region 172 186 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
ARM 475 516 1.38e1 SMART
ARM 517 557 2.38e-2 SMART
ARM 558 613 3.97e0 SMART
ARM 614 654 2.59e-3 SMART
ARM 655 695 3.48e1 SMART
ARM 696 737 1.6e1 SMART
ARM 738 778 4.09e0 SMART
ARM 779 819 9.68e0 SMART
ARM 861 903 3.52e0 SMART
ARM 904 944 1.26e1 SMART
ARM 945 985 1.03e1 SMART
ARM 986 1026 1.13e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. This protein has been shown to localize to the ciliary axonemes and at the ciliary base of respiratory cells. Studies indicate that mutations in this gene cause partial outer dynein arm (ODA) defects in respiratory cilia. The cilia of cells with mutations in this gene displayed either reduced ciliary beat frequency and amplitude, or, complete immotility. Some individuals with primary ciliary dyskensia (PCD) have been shown to have mutations in this gene. PCD is characterized by chronic airway disease and left/right body asymmetry defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit situs inversus totalis or heterotaxia with congenital heart disease including double outlet right ventricle and ventricular septal defects. Dyskinetic, slow, or immotile airway cilia are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700042G07Rik T C 4: 116,173,615 I72T probably damaging Het
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Aadacl4 T A 4: 144,617,858 M68K probably benign Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Cdcp1 T A 9: 123,183,705 H259L possibly damaging Het
Ckap4 T C 10: 84,533,490 Q126R probably benign Het
Clec18a C T 8: 111,075,461 V299I probably benign Het
D7Ertd443e A G 7: 134,349,722 I27T possibly damaging Het
Dlg2 T G 7: 92,444,527 D726E probably benign Het
Dnah8 T C 17: 30,728,191 I1856T possibly damaging Het
Espl1 G A 15: 102,322,576 V1837I probably benign Het
Fanca G T 8: 123,295,053 probably benign Het
Fer1l5 A G 1: 36,388,935 T437A probably benign Het
Gm10644 C A 8: 83,934,039 probably benign Het
Katnb1 A G 8: 95,098,712 S635G probably benign Het
Map3k12 A G 15: 102,504,235 V234A possibly damaging Het
Mks1 A G 11: 87,856,870 N193S probably benign Het
Mmp11 T C 10: 75,927,389 E151G probably damaging Het
Napg A G 18: 62,994,369 R265G possibly damaging Het
Olfr49 A G 14: 54,282,565 F110S possibly damaging Het
Olfr513 T A 7: 108,755,574 C239* probably null Het
Pcdha7 G T 18: 36,975,083 C387F probably damaging Het
Pcdhb3 G T 18: 37,301,647 R222L probably benign Het
Phf2 A G 13: 48,820,070 M373T unknown Het
Plekha7 T C 7: 116,140,399 T636A probably damaging Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Rnf6 G A 5: 146,211,149 P353L probably benign Het
Sel1l3 A C 5: 53,184,808 L357V possibly damaging Het
Sh3rf3 T A 10: 58,984,153 M262K possibly damaging Het
Sorcs3 A T 19: 48,788,511 H994L probably damaging Het
Thsd7a A T 6: 12,503,923 C411S probably damaging Het
Ttn T C 2: 76,763,338 K20653E probably damaging Het
Ttn A G 2: 76,780,920 W15677R probably damaging Het
Ttn A C 2: 76,878,564 probably null Het
Ubr2 T C 17: 46,956,655 M1049V possibly damaging Het
Other mutations in Armc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Armc4 APN 18 7211504 missense probably damaging 0.96
IGL00822:Armc4 APN 18 7181817 missense probably damaging 1.00
IGL01345:Armc4 APN 18 7266947 missense probably benign 0.00
IGL01593:Armc4 APN 18 7127345 missense probably benign 0.00
IGL01645:Armc4 APN 18 7268491 missense probably benign 0.00
IGL01863:Armc4 APN 18 7222617 missense probably damaging 1.00
IGL01955:Armc4 APN 18 7127291 missense possibly damaging 0.89
IGL02013:Armc4 APN 18 7265157 splice site probably benign
IGL02142:Armc4 APN 18 7214601 missense probably damaging 1.00
IGL02399:Armc4 APN 18 7285719 missense probably benign
IGL02439:Armc4 APN 18 7268444 missense probably benign 0.04
IGL02452:Armc4 APN 18 7129461 missense probably damaging 1.00
IGL02632:Armc4 APN 18 7214727 splice site probably benign
IGL03344:Armc4 APN 18 7129434 nonsense probably null
R0062:Armc4 UTSW 18 7129593 splice site probably benign
R0062:Armc4 UTSW 18 7129593 splice site probably benign
R0242:Armc4 UTSW 18 7211516 missense probably damaging 0.96
R0242:Armc4 UTSW 18 7211516 missense probably damaging 0.96
R0365:Armc4 UTSW 18 7217800 missense probably benign 0.01
R0377:Armc4 UTSW 18 7127415 missense probably benign 0.04
R0466:Armc4 UTSW 18 7286758 missense probably benign 0.10
R0517:Armc4 UTSW 18 7223621 missense probably damaging 1.00
R0521:Armc4 UTSW 18 7222676 missense possibly damaging 0.64
R0841:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1145:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1145:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1435:Armc4 UTSW 18 7222646 missense probably benign 0.01
R1487:Armc4 UTSW 18 7273245 missense probably damaging 0.98
R1634:Armc4 UTSW 18 7286688 missense probably damaging 0.99
R1677:Armc4 UTSW 18 7222554 missense probably benign 0.01
R1778:Armc4 UTSW 18 7127388 missense probably damaging 1.00
R1792:Armc4 UTSW 18 7286743 missense probably benign 0.00
R1809:Armc4 UTSW 18 7211630 missense probably benign 0.08
R1842:Armc4 UTSW 18 7223551 missense probably benign 0.04
R2144:Armc4 UTSW 18 7127229 missense probably damaging 0.96
R2206:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2273:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2275:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2918:Armc4 UTSW 18 7222625 missense probably benign 0.04
R3421:Armc4 UTSW 18 7223523 splice site probably benign
R3422:Armc4 UTSW 18 7223523 splice site probably benign
R4165:Armc4 UTSW 18 7217008 missense probably damaging 1.00
R4225:Armc4 UTSW 18 7181732 critical splice donor site probably null
R4660:Armc4 UTSW 18 7211609 missense possibly damaging 0.88
R4745:Armc4 UTSW 18 7286763 missense probably benign 0.28
R4812:Armc4 UTSW 18 7288634 missense possibly damaging 0.79
R4831:Armc4 UTSW 18 7222564 missense possibly damaging 0.79
R4923:Armc4 UTSW 18 7181787 missense probably damaging 0.97
R4995:Armc4 UTSW 18 7223663 missense probably damaging 1.00
R5024:Armc4 UTSW 18 7088555 missense probably benign 0.02
R5335:Armc4 UTSW 18 7294566 missense probably benign 0.06
R5434:Armc4 UTSW 18 7222550 missense probably benign 0.03
R5552:Armc4 UTSW 18 7285360 missense possibly damaging 0.51
R5719:Armc4 UTSW 18 7211496 missense probably benign 0.00
R5736:Armc4 UTSW 18 7268416 missense probably benign 0.01
R5792:Armc4 UTSW 18 7217965 missense probably benign 0.00
R5957:Armc4 UTSW 18 7285706 missense probably benign 0.01
R6001:Armc4 UTSW 18 7286838 missense probably benign 0.03
R6309:Armc4 UTSW 18 7214617 missense probably benign 0.04
R6559:Armc4 UTSW 18 7223664 missense probably damaging 0.99
R6574:Armc4 UTSW 18 7129394 splice site probably null
R6581:Armc4 UTSW 18 7129560 missense possibly damaging 0.77
R6736:Armc4 UTSW 18 7223586 missense probably damaging 0.98
R6842:Armc4 UTSW 18 7268401 missense probably benign 0.00
R6974:Armc4 UTSW 18 7294479 missense probably benign 0.37
Z1088:Armc4 UTSW 18 7266919 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTAACATGGCATACAATTCCAGG -3'
(R):5'- CTAAGCCACAGCAAGTAGATGC -3'

Sequencing Primer
(F):5'- TCAACAGTTACTCTCCAGT -3'
(R):5'- TGCCTATGAGAGTCAGCTGAC -3'
Posted On2017-02-10