Incidental Mutation 'R5861:Arhgap10'
ID453917
Institutional Source Beutler Lab
Gene Symbol Arhgap10
Ensembl Gene ENSMUSG00000037148
Gene NameRho GTPase activating protein 10
SynonymsPSGAP-m, A930033B01Rik, PSGAP-s
MMRRC Submission 044073-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5861 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location77250366-77517953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 77310764 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 612 (A612T)
Ref Sequence ENSEMBL: ENSMUSP00000147485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076316] [ENSMUST00000210519] [ENSMUST00000210922]
Predicted Effect probably damaging
Transcript: ENSMUST00000076316
AA Change: A612T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075658
Gene: ENSMUSG00000037148
AA Change: A612T

DomainStartEndE-ValueType
Pfam:BAR_3 6 249 3.3e-91 PFAM
PH 266 374 1.93e-6 SMART
RhoGAP 393 571 1.66e-63 SMART
low complexity region 633 649 N/A INTRINSIC
SH3 731 786 1.91e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209302
Predicted Effect probably benign
Transcript: ENSMUST00000210519
AA Change: A590T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000210922
AA Change: A612T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency 98% (81/83)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit paraparesis, ataxic hindlimbs and splaying of hindlimbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,298,812 D143G probably damaging Het
Abcc5 G T 16: 20,399,894 T246N probably damaging Het
Arsg T A 11: 109,563,188 F407I probably damaging Het
Asxl1 C A 2: 153,399,390 A620D probably damaging Het
BC080695 G T 4: 143,571,240 V77L probably benign Het
C2cd3 A G 7: 100,444,475 probably benign Het
Chn2 G A 6: 54,290,374 V92I probably damaging Het
Cog2 T C 8: 124,537,878 F332S probably damaging Het
Crhbp G A 13: 95,443,825 A82V probably damaging Het
Cyp2j6 A G 4: 96,545,803 V90A possibly damaging Het
Dennd4c A T 4: 86,791,352 M397L probably benign Het
Dnajb8 A G 6: 88,223,106 D208G possibly damaging Het
Ecm1 G C 3: 95,736,597 L230V probably damaging Het
Ercc2 G C 7: 19,394,141 A696P possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gm13035 A G 4: 146,073,289 noncoding transcript Het
Gm28042 T C 2: 120,034,635 V247A probably damaging Het
Gm28455 T A 7: 39,498,579 noncoding transcript Het
Gpr150 A T 13: 76,056,073 V251D possibly damaging Het
Grip1 C T 10: 119,929,970 S69L probably damaging Het
Hs6st3 A G 14: 119,138,853 I147V possibly damaging Het
Il5 G A 11: 53,723,916 E102K probably benign Het
Kif1c T C 11: 70,703,795 F94L probably damaging Het
Lrrc63 T C 14: 75,107,366 E427G possibly damaging Het
Man1b1 A G 2: 25,348,054 T384A probably benign Het
Mapk15 C A 15: 75,996,359 probably benign Het
Mfsd10 T C 5: 34,634,244 probably benign Het
Mgat5 C A 1: 127,387,392 A285E probably damaging Het
Mroh4 T A 15: 74,606,607 probably benign Het
Myf5 A T 10: 107,484,208 C194S probably benign Het
Myh7 A G 14: 54,988,890 V431A possibly damaging Het
Nadsyn1 A C 7: 143,811,227 M247R possibly damaging Het
Nipsnap3b A G 4: 53,021,177 D166G probably damaging Het
Nqo2 A T 13: 33,972,430 L42F probably damaging Het
Nt5dc3 A T 10: 86,815,874 D180V probably damaging Het
Numa1 C A 7: 102,009,287 probably null Het
Olfm3 T A 3: 115,122,403 L328Q probably damaging Het
Olfr1141 A T 2: 87,753,578 N138K probably benign Het
Olfr1353 A T 10: 78,969,931 Y94F probably damaging Het
Olfr1508 T C 14: 52,463,496 Y171C probably damaging Het
Papolb T C 5: 142,529,237 N217S possibly damaging Het
Pcmtd2 C A 2: 181,842,475 T26K probably damaging Het
Pld5 T G 1: 176,090,005 N59H probably damaging Het
Ppm1d T C 11: 85,311,848 S126P possibly damaging Het
Ppp1r21 T C 17: 88,582,509 L727P probably damaging Het
Prpsap2 C T 11: 61,737,044 R202H probably damaging Het
Rara T A 11: 98,968,161 C148* probably null Het
Rexo2 A T 9: 48,475,181 I83N probably damaging Het
Rnf213 A G 11: 119,473,377 R4501G probably damaging Het
Rps5 T A 7: 12,925,574 F97L probably damaging Het
Sigirr G A 7: 141,091,379 R397W probably damaging Het
Slc6a6 T C 6: 91,741,033 Y318H probably damaging Het
Spam1 A G 6: 24,796,571 T174A probably benign Het
Stam2 G T 2: 52,742,104 probably benign Het
Taar7a T C 10: 23,992,439 E348G probably benign Het
Taf11 T C 17: 27,901,670 T209A probably benign Het
Tenm4 A G 7: 96,843,217 probably benign Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Trim5 G T 7: 104,279,519 H72N probably benign Het
Trim5 A C 7: 104,279,521 L71R probably benign Het
Uevld A T 7: 46,926,356 S461T probably benign Het
Vmn2r6 T A 3: 64,556,033 N460I probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zfp316 T C 5: 143,263,340 Y180C unknown Het
Zfp941 A G 7: 140,812,139 S436P probably damaging Het
Zfp979 G A 4: 147,613,509 Q248* probably null Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Arhgap10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Arhgap10 APN 8 77346291 missense possibly damaging 0.80
IGL01689:Arhgap10 APN 8 77411134 splice site probably benign
IGL01802:Arhgap10 APN 8 77420085 missense probably damaging 0.99
IGL01832:Arhgap10 APN 8 77259129 missense probably benign 0.00
IGL02291:Arhgap10 APN 8 77382715 splice site probably benign
IGL02834:Arhgap10 APN 8 77365100 missense probably damaging 1.00
IGL02928:Arhgap10 APN 8 77250910 unclassified probably benign
IGL03149:Arhgap10 APN 8 77409538 splice site probably benign
IGL03215:Arhgap10 APN 8 77277152 missense probably benign
IGL03331:Arhgap10 APN 8 77420082 missense probably damaging 0.99
R0276:Arhgap10 UTSW 8 77413581 missense probably benign 0.11
R0376:Arhgap10 UTSW 8 77450824 splice site probably benign
R0454:Arhgap10 UTSW 8 77250965 missense probably damaging 0.97
R0714:Arhgap10 UTSW 8 77351687 splice site probably benign
R1033:Arhgap10 UTSW 8 77257347 missense possibly damaging 0.80
R1036:Arhgap10 UTSW 8 77310769 missense probably damaging 0.98
R1083:Arhgap10 UTSW 8 77517749 missense probably damaging 1.00
R1596:Arhgap10 UTSW 8 77450697 missense possibly damaging 0.93
R1710:Arhgap10 UTSW 8 77358587 nonsense probably null
R1918:Arhgap10 UTSW 8 77259079 missense probably benign
R1937:Arhgap10 UTSW 8 77344653 missense probably damaging 1.00
R1959:Arhgap10 UTSW 8 77409626 missense possibly damaging 0.78
R2348:Arhgap10 UTSW 8 77450926 splice site probably benign
R3703:Arhgap10 UTSW 8 77259056 critical splice donor site probably null
R3979:Arhgap10 UTSW 8 77420725 missense probably benign 0.01
R4854:Arhgap10 UTSW 8 77420089 nonsense probably null
R4855:Arhgap10 UTSW 8 77432738 critical splice donor site probably null
R4928:Arhgap10 UTSW 8 77426328 critical splice donor site probably null
R5033:Arhgap10 UTSW 8 77382757 missense probably damaging 0.99
R5532:Arhgap10 UTSW 8 77420072 missense probably benign 0.19
R5644:Arhgap10 UTSW 8 77411055 missense probably benign 0.00
R5781:Arhgap10 UTSW 8 77450707 missense possibly damaging 0.56
R5824:Arhgap10 UTSW 8 77358552 nonsense probably null
R5872:Arhgap10 UTSW 8 77344638 critical splice donor site probably null
R6360:Arhgap10 UTSW 8 77259202 nonsense probably null
R6423:Arhgap10 UTSW 8 77517757 missense probably damaging 1.00
R6694:Arhgap10 UTSW 8 77411063 missense probably benign 0.00
R6900:Arhgap10 UTSW 8 77310862 missense probably damaging 1.00
R6936:Arhgap10 UTSW 8 77310747 nonsense probably null
R7001:Arhgap10 UTSW 8 77365088 missense possibly damaging 0.51
R7150:Arhgap10 UTSW 8 77250954 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTCTGACCAGAAAGCG -3'
(R):5'- GTGGCTGGACTCTGCTTTAC -3'

Sequencing Primer
(F):5'- GAAAGCGTCACCCTCCCTG -3'
(R):5'- TTTACTCCAGCAGTGCACAGG -3'
Posted On2017-02-10