Incidental Mutation 'R5862:Sfmbt2'
ID453951
Institutional Source Beutler Lab
Gene Symbol Sfmbt2
Ensembl Gene ENSMUSG00000061186
Gene NameScm-like with four mbt domains 2
SynonymsD2Wsu23e, D330030P06Rik
MMRRC Submission 043231-MU
Accession Numbers

Genbank: NM_177386; MGI: 2447794

Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R5862 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location10370510-10595253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10402052 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 54 (T54I)
Ref Sequence ENSEMBL: ENSMUSP00000040575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041105] [ENSMUST00000114861] [ENSMUST00000114862] [ENSMUST00000114864] [ENSMUST00000116594]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041105
AA Change: T54I

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000040575
Gene: ENSMUSG00000061186
AA Change: T54I

DomainStartEndE-ValueType
MBT 43 143 2.49e-44 SMART
MBT 151 255 2.03e-35 SMART
MBT 265 371 3.6e-27 SMART
MBT 379 475 4.15e-41 SMART
Pfam:DUF3588 528 643 1.4e-37 PFAM
low complexity region 719 738 N/A INTRINSIC
low complexity region 741 755 N/A INTRINSIC
low complexity region 853 869 N/A INTRINSIC
SAM 902 968 1.12e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114861
AA Change: T54I

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110511
Gene: ENSMUSG00000061186
AA Change: T54I

DomainStartEndE-ValueType
MBT 43 143 2.49e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114862
AA Change: T54I

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110512
Gene: ENSMUSG00000061186
AA Change: T54I

DomainStartEndE-ValueType
MBT 43 143 2.49e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114864
AA Change: T54I

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110514
Gene: ENSMUSG00000061186
AA Change: T54I

DomainStartEndE-ValueType
MBT 43 143 2.49e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116594
AA Change: T54I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000112293
Gene: ENSMUSG00000061186
AA Change: T54I

DomainStartEndE-ValueType
MBT 43 143 2.49e-44 SMART
MBT 151 255 2.03e-35 SMART
MBT 265 371 3.6e-27 SMART
MBT 379 475 4.15e-41 SMART
Pfam:DUF3588 527 646 2.9e-40 PFAM
low complexity region 657 670 N/A INTRINSIC
low complexity region 686 705 N/A INTRINSIC
low complexity region 708 722 N/A INTRINSIC
internal_repeat_2 725 744 1.3e-5 PROSPERO
internal_repeat_2 745 764 1.3e-5 PROSPERO
low complexity region 820 836 N/A INTRINSIC
SAM 869 935 1.12e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126531
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A G 1: 179,788,330 Y326H probably damaging Het
Alpk2 T A 18: 65,307,289 K811N probably damaging Het
Ap3b1 T A 13: 94,547,770 M1014K unknown Het
Bphl G A 13: 34,063,984 V247I possibly damaging Het
C6 A T 15: 4,735,263 D147V possibly damaging Het
Clec18a G A 8: 111,081,558 H71Y possibly damaging Het
Cse1l A G 2: 166,915,207 T10A probably benign Het
Cyp2b9 G T 7: 26,187,807 G214C probably benign Het
Dctn6 A T 8: 34,108,417 probably null Het
Dnaja4 G T 9: 54,699,341 probably benign Het
Dpp8 A T 9: 65,045,722 S227C probably benign Het
Ecel1 T C 1: 87,149,596 N630S probably benign Het
Etnppl T C 3: 130,631,824 V426A possibly damaging Het
Golgb1 A T 16: 36,926,091 silent Het
H2afy T A 13: 56,074,271 I359L probably damaging Het
Hapln3 A T 7: 79,121,891 H83Q possibly damaging Het
Hmgxb4 A G 8: 75,001,055 K222R probably damaging Het
Hsf5 C A 11: 87,622,991 T294K probably damaging Het
Ighv12-2 A G 12: 114,127,937 noncoding transcript Het
Lrch3 A T 16: 32,995,809 H587L probably damaging Het
Mboat1 C T 13: 30,235,697 T339M probably damaging Het
Mief1 G A 15: 80,248,385 R156Q probably benign Het
Ms4a6b T A 19: 11,521,803 F94I probably benign Het
Neb T A 2: 52,179,542 R307* probably null Het
Neu4 A G 1: 94,022,930 I147V probably benign Het
Olfr1036 T C 2: 86,075,646 I302T probably benign Het
Pcyox1 A G 6: 86,391,674 probably null Het
Pik3ap1 T A 19: 41,332,345 D145V probably damaging Het
Pja2 T C 17: 64,297,826 D454G probably benign Het
Plekhg1 C T 10: 3,937,914 T281M probably damaging Het
Ptprq T C 10: 107,565,878 I1918V probably benign Het
Rasgef1a A C 6: 118,080,444 R35S probably benign Het
Rnf167 A G 11: 70,651,092 T308A probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shkbp1 G T 7: 27,343,404 S536* probably null Het
Taf2 C A 15: 55,048,323 V566L possibly damaging Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tyms A T 5: 30,063,410 D97E probably damaging Het
Usp20 T A 2: 31,006,449 L188* probably null Het
Zbtb10 T A 3: 9,265,216 S545T probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Sfmbt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Sfmbt2 APN 2 10402007 missense probably damaging 1.00
IGL01294:Sfmbt2 APN 2 10590421 splice site probably benign
IGL01503:Sfmbt2 APN 2 10579354 nonsense probably null
IGL01996:Sfmbt2 APN 2 10440026 missense probably benign 0.05
IGL02071:Sfmbt2 APN 2 10577952 missense probably benign 0.17
IGL02440:Sfmbt2 APN 2 10568383 missense probably damaging 1.00
IGL02718:Sfmbt2 APN 2 10402031 missense possibly damaging 0.69
IGL03213:Sfmbt2 APN 2 10404574 missense probably damaging 1.00
IGL03325:Sfmbt2 APN 2 10577817 missense probably damaging 1.00
3-1:Sfmbt2 UTSW 2 10404466 missense probably damaging 1.00
D605:Sfmbt2 UTSW 2 10579325 missense probably benign 0.08
R0919:Sfmbt2 UTSW 2 10577571 missense probably benign 0.04
R1180:Sfmbt2 UTSW 2 10402066 missense probably damaging 1.00
R2391:Sfmbt2 UTSW 2 10445693 missense possibly damaging 0.89
R4208:Sfmbt2 UTSW 2 10542982 missense probably damaging 1.00
R4898:Sfmbt2 UTSW 2 10579258 missense possibly damaging 0.76
R4928:Sfmbt2 UTSW 2 10445745 missense probably benign 0.17
R5643:Sfmbt2 UTSW 2 10568373 missense probably damaging 0.99
R5644:Sfmbt2 UTSW 2 10568373 missense probably damaging 0.99
R5990:Sfmbt2 UTSW 2 10579381 missense possibly damaging 0.65
R6721:Sfmbt2 UTSW 2 10543025 missense probably damaging 0.99
R7098:Sfmbt2 UTSW 2 10579189 missense probably benign 0.04
R7133:Sfmbt2 UTSW 2 10402007 missense probably damaging 1.00
Z1088:Sfmbt2 UTSW 2 10579183 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTCTTCCACAGCGAGCTTAAG -3'
(R):5'- TGTTTCAGGAGCAGCTATCTTC -3'

Sequencing Primer
(F):5'- CACAGCGAGCTTAAGTTCTTGCG -3'
(R):5'- ACCCCGCCTCATCTAGC -3'
Posted On2017-02-10