Incidental Mutation 'R5862:Rnf167'
ID453974
Institutional Source Beutler Lab
Gene Symbol Rnf167
Ensembl Gene ENSMUSG00000040746
Gene Namering finger protein 167
Synonyms0610010G05Rik, 5730408C10Rik
MMRRC Submission 043231-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5862 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70647235-70651421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70651092 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 308 (T308A)
Ref Sequence ENSEMBL: ENSMUSP00000036472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014750] [ENSMUST00000018437] [ENSMUST00000037534] [ENSMUST00000108549] [ENSMUST00000136383] [ENSMUST00000139638] [ENSMUST00000141695] [ENSMUST00000152160] [ENSMUST00000178254]
Predicted Effect probably benign
Transcript: ENSMUST00000014750
SMART Domains Protein: ENSMUSP00000014750
Gene: ENSMUSG00000014606

DomainStartEndE-ValueType
Pfam:Mito_carr 18 112 1.3e-22 PFAM
Pfam:Mito_carr 115 213 2.6e-19 PFAM
Pfam:Mito_carr 216 311 5.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000018437
SMART Domains Protein: ENSMUSP00000018437
Gene: ENSMUSG00000018293

DomainStartEndE-ValueType
PROF 2 140 4.46e-58 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000037534
AA Change: T308A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036472
Gene: ENSMUSG00000040746
AA Change: T308A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PA 53 150 1.4e-14 PFAM
transmembrane domain 172 194 N/A INTRINSIC
RING 230 271 2.65e-9 SMART
low complexity region 278 303 N/A INTRINSIC
low complexity region 332 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108549
SMART Domains Protein: ENSMUSP00000104189
Gene: ENSMUSG00000018293

DomainStartEndE-ValueType
Pfam:Profilin 3 109 7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131642
Predicted Effect probably benign
Transcript: ENSMUST00000136383
SMART Domains Protein: ENSMUSP00000120900
Gene: ENSMUSG00000014606

DomainStartEndE-ValueType
Pfam:Mito_carr 1 75 9.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139638
SMART Domains Protein: ENSMUSP00000114685
Gene: ENSMUSG00000014606

DomainStartEndE-ValueType
Pfam:Mito_carr 1 80 7.4e-17 PFAM
Pfam:Mito_carr 83 181 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141537
Predicted Effect probably benign
Transcript: ENSMUST00000141695
SMART Domains Protein: ENSMUSP00000121511
Gene: ENSMUSG00000040746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151034
Predicted Effect probably benign
Transcript: ENSMUST00000152160
SMART Domains Protein: ENSMUSP00000115057
Gene: ENSMUSG00000040746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177669
Predicted Effect probably benign
Transcript: ENSMUST00000178254
SMART Domains Protein: ENSMUSP00000136219
Gene: ENSMUSG00000018293

DomainStartEndE-ValueType
Pfam:Profilin 3 54 1.4e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RNF167 is an E3 ubiquitin ligase that interacts with TSSC5 (SLC22A18; MIM 602631) and, together with UBCH6 (UBE2E1; MIM 602916), facilitates TSSC5 polyubiquitylation (Yamada and Gorbsky, 2006 [PubMed 16314844]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A G 1: 179,788,330 Y326H probably damaging Het
Alpk2 T A 18: 65,307,289 K811N probably damaging Het
Ap3b1 T A 13: 94,547,770 M1014K unknown Het
Bphl G A 13: 34,063,984 V247I possibly damaging Het
C6 A T 15: 4,735,263 D147V possibly damaging Het
Clec18a G A 8: 111,081,558 H71Y possibly damaging Het
Cse1l A G 2: 166,915,207 T10A probably benign Het
Cyp2b9 G T 7: 26,187,807 G214C probably benign Het
Dctn6 A T 8: 34,108,417 probably null Het
Dnaja4 G T 9: 54,699,341 probably benign Het
Dpp8 A T 9: 65,045,722 S227C probably benign Het
Ecel1 T C 1: 87,149,596 N630S probably benign Het
Etnppl T C 3: 130,631,824 V426A possibly damaging Het
Golgb1 A T 16: 36,926,091 silent Het
H2afy T A 13: 56,074,271 I359L probably damaging Het
Hapln3 A T 7: 79,121,891 H83Q possibly damaging Het
Hmgxb4 A G 8: 75,001,055 K222R probably damaging Het
Hsf5 C A 11: 87,622,991 T294K probably damaging Het
Ighv12-2 A G 12: 114,127,937 noncoding transcript Het
Lrch3 A T 16: 32,995,809 H587L probably damaging Het
Mboat1 C T 13: 30,235,697 T339M probably damaging Het
Mief1 G A 15: 80,248,385 R156Q probably benign Het
Ms4a6b T A 19: 11,521,803 F94I probably benign Het
Neb T A 2: 52,179,542 R307* probably null Het
Neu4 A G 1: 94,022,930 I147V probably benign Het
Olfr1036 T C 2: 86,075,646 I302T probably benign Het
Pcyox1 A G 6: 86,391,674 probably null Het
Pik3ap1 T A 19: 41,332,345 D145V probably damaging Het
Pja2 T C 17: 64,297,826 D454G probably benign Het
Plekhg1 C T 10: 3,937,914 T281M probably damaging Het
Ptprq T C 10: 107,565,878 I1918V probably benign Het
Rasgef1a A C 6: 118,080,444 R35S probably benign Het
Sfmbt2 C T 2: 10,402,052 T54I possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shkbp1 G T 7: 27,343,404 S536* probably null Het
Taf2 C A 15: 55,048,323 V566L possibly damaging Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tyms A T 5: 30,063,410 D97E probably damaging Het
Usp20 T A 2: 31,006,449 L188* probably null Het
Zbtb10 T A 3: 9,265,216 S545T probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Rnf167
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02336:Rnf167 APN 11 70650126 missense probably benign
IGL03407:Rnf167 APN 11 70651053 unclassified probably null
R0366:Rnf167 UTSW 11 70649317 nonsense probably null
R0415:Rnf167 UTSW 11 70649699 missense probably damaging 0.99
R1799:Rnf167 UTSW 11 70650012 missense probably benign 0.00
R1869:Rnf167 UTSW 11 70650139 missense possibly damaging 0.86
R2291:Rnf167 UTSW 11 70649303 missense probably damaging 1.00
R3547:Rnf167 UTSW 11 70649681 missense possibly damaging 0.46
R4418:Rnf167 UTSW 11 70647917 missense probably damaging 1.00
R4798:Rnf167 UTSW 11 70650135 missense probably benign 0.32
R4973:Rnf167 UTSW 11 70649875 unclassified probably benign
R5145:Rnf167 UTSW 11 70650080 unclassified probably benign
R5585:Rnf167 UTSW 11 70649482 missense probably damaging 0.99
R6576:Rnf167 UTSW 11 70649762 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ACAGCTTATCACAGTCGCTG -3'
(R):5'- TGAACCTGGGGTAGAATGTCCC -3'

Sequencing Primer
(F):5'- ACAGTCGCTGTGTGGACC -3'
(R):5'- GGGTAGAATGTCCCCTATCCC -3'
Posted On2017-02-10