Incidental Mutation 'R5862:Lrch3'
ID453984
Institutional Source Beutler Lab
Gene Symbol Lrch3
Ensembl Gene ENSMUSG00000022801
Gene Nameleucine-rich repeats and calponin homology (CH) domain containing 3
Synonyms2210409B11Rik, LOC385628
MMRRC Submission 043231-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R5862 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location32914100-33015647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32995809 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 587 (H587L)
Ref Sequence ENSEMBL: ENSMUSP00000023491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023491] [ENSMUST00000135193] [ENSMUST00000165616] [ENSMUST00000165826] [ENSMUST00000170201] [ENSMUST00000170899]
Predicted Effect probably damaging
Transcript: ENSMUST00000023491
AA Change: H587L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023491
Gene: ENSMUSG00000022801
AA Change: H587L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 754 9.24e-15 SMART
low complexity region 759 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105610
Predicted Effect probably benign
Transcript: ENSMUST00000135193
AA Change: H587L

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000130708
Gene: ENSMUSG00000022801
AA Change: H587L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 651 755 6.79e-13 SMART
transmembrane domain 771 793 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000142290
AA Change: H140L
SMART Domains Protein: ENSMUSP00000117302
Gene: ENSMUSG00000022801
AA Change: H140L

DomainStartEndE-ValueType
low complexity region 31 42 N/A INTRINSIC
low complexity region 88 103 N/A INTRINSIC
SCOP:d1h67a_ 201 253 1e-11 SMART
Blast:CH 205 253 6e-27 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000163428
AA Change: H169L
SMART Domains Protein: ENSMUSP00000133034
Gene: ENSMUSG00000022801
AA Change: H169L

DomainStartEndE-ValueType
low complexity region 122 137 N/A INTRINSIC
SCOP:d1h67a_ 230 265 9e-5 SMART
Blast:CH 234 265 7e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000165616
AA Change: H433L

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000130009
Gene: ENSMUSG00000022801
AA Change: H433L

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Blast:LRR 89 113 1e-6 BLAST
Blast:LRR 114 137 3e-7 BLAST
low complexity region 328 339 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
CH 497 600 9.24e-15 SMART
low complexity region 605 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165826
SMART Domains Protein: ENSMUSP00000126308
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 105 116 N/A INTRINSIC
low complexity region 162 177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170201
SMART Domains Protein: ENSMUSP00000126964
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 482 493 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
CH 615 718 9.24e-15 SMART
low complexity region 723 738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170899
SMART Domains Protein: ENSMUSP00000127547
Gene: ENSMUSG00000022801

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
LRR 104 126 2.54e1 SMART
LRR 127 150 2.86e-1 SMART
LRR 172 194 4.44e0 SMART
LRR 195 218 4.33e1 SMART
LRR 240 263 2.76e1 SMART
low complexity region 489 504 N/A INTRINSIC
CH 565 668 9.24e-15 SMART
low complexity region 673 688 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A G 1: 179,788,330 Y326H probably damaging Het
Alpk2 T A 18: 65,307,289 K811N probably damaging Het
Ap3b1 T A 13: 94,547,770 M1014K unknown Het
Bphl G A 13: 34,063,984 V247I possibly damaging Het
C6 A T 15: 4,735,263 D147V possibly damaging Het
Clec18a G A 8: 111,081,558 H71Y possibly damaging Het
Cse1l A G 2: 166,915,207 T10A probably benign Het
Cyp2b9 G T 7: 26,187,807 G214C probably benign Het
Dctn6 A T 8: 34,108,417 probably null Het
Dnaja4 G T 9: 54,699,341 probably benign Het
Dpp8 A T 9: 65,045,722 S227C probably benign Het
Ecel1 T C 1: 87,149,596 N630S probably benign Het
Etnppl T C 3: 130,631,824 V426A possibly damaging Het
Golgb1 A T 16: 36,926,091 silent Het
H2afy T A 13: 56,074,271 I359L probably damaging Het
Hapln3 A T 7: 79,121,891 H83Q possibly damaging Het
Hmgxb4 A G 8: 75,001,055 K222R probably damaging Het
Hsf5 C A 11: 87,622,991 T294K probably damaging Het
Ighv12-2 A G 12: 114,127,937 noncoding transcript Het
Mboat1 C T 13: 30,235,697 T339M probably damaging Het
Mief1 G A 15: 80,248,385 R156Q probably benign Het
Ms4a6b T A 19: 11,521,803 F94I probably benign Het
Neb T A 2: 52,179,542 R307* probably null Het
Neu4 A G 1: 94,022,930 I147V probably benign Het
Olfr1036 T C 2: 86,075,646 I302T probably benign Het
Pcyox1 A G 6: 86,391,674 probably null Het
Pik3ap1 T A 19: 41,332,345 D145V probably damaging Het
Pja2 T C 17: 64,297,826 D454G probably benign Het
Plekhg1 C T 10: 3,937,914 T281M probably damaging Het
Ptprq T C 10: 107,565,878 I1918V probably benign Het
Rasgef1a A C 6: 118,080,444 R35S probably benign Het
Rnf167 A G 11: 70,651,092 T308A probably damaging Het
Sfmbt2 C T 2: 10,402,052 T54I possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shkbp1 G T 7: 27,343,404 S536* probably null Het
Taf2 C A 15: 55,048,323 V566L possibly damaging Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tyms A T 5: 30,063,410 D97E probably damaging Het
Usp20 T A 2: 31,006,449 L188* probably null Het
Zbtb10 T A 3: 9,265,216 S545T probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Lrch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Lrch3 APN 16 32994965 missense probably benign 0.10
IGL01400:Lrch3 APN 16 32979541 missense probably damaging 1.00
IGL02565:Lrch3 APN 16 33005714 missense probably benign 0.00
IGL03076:Lrch3 APN 16 32981853 missense possibly damaging 0.52
IGL03103:Lrch3 APN 16 32952137 missense probably damaging 1.00
IGL03125:Lrch3 APN 16 32914277 missense possibly damaging 0.83
IGL03349:Lrch3 APN 16 32955324 missense probably damaging 1.00
R0054:Lrch3 UTSW 16 32995852 intron probably benign
R0123:Lrch3 UTSW 16 32961754 splice site probably benign
R0225:Lrch3 UTSW 16 32961754 splice site probably benign
R0326:Lrch3 UTSW 16 32979500 missense probably damaging 1.00
R0455:Lrch3 UTSW 16 32986880 missense probably damaging 0.99
R0734:Lrch3 UTSW 16 32997483 nonsense probably null
R1204:Lrch3 UTSW 16 33009214 missense probably damaging 1.00
R1470:Lrch3 UTSW 16 32988495 splice site probably benign
R1526:Lrch3 UTSW 16 32950376 missense probably damaging 1.00
R1597:Lrch3 UTSW 16 32950411 nonsense probably null
R1850:Lrch3 UTSW 16 32986793 missense probably benign 0.01
R1966:Lrch3 UTSW 16 32914385 missense possibly damaging 0.94
R2241:Lrch3 UTSW 16 32995841 missense probably damaging 0.99
R2313:Lrch3 UTSW 16 32961675 missense probably damaging 1.00
R2902:Lrch3 UTSW 16 32950396 missense probably damaging 1.00
R4723:Lrch3 UTSW 16 32988484 splice site probably null
R4795:Lrch3 UTSW 16 33005704 missense probably damaging 1.00
R4970:Lrch3 UTSW 16 32998513 missense probably damaging 1.00
R5223:Lrch3 UTSW 16 32914397 missense probably damaging 0.99
R5292:Lrch3 UTSW 16 32975807 missense probably damaging 1.00
R5414:Lrch3 UTSW 16 32985965 unclassified probably null
R5470:Lrch3 UTSW 16 32998590 missense probably damaging 1.00
R5594:Lrch3 UTSW 16 32914184 missense probably damaging 0.99
R5843:Lrch3 UTSW 16 32998526 missense probably damaging 1.00
R5911:Lrch3 UTSW 16 32959463 missense probably damaging 1.00
R5932:Lrch3 UTSW 16 32975736 missense probably damaging 1.00
R6519:Lrch3 UTSW 16 32994997 critical splice donor site probably benign
R6731:Lrch3 UTSW 16 32950420 missense probably damaging 1.00
R7182:Lrch3 UTSW 16 32993779 missense not run
R7197:Lrch3 UTSW 16 32990295 missense not run
R7319:Lrch3 UTSW 16 32994993 missense not run
Predicted Primers PCR Primer
(F):5'- GGTTCGCAAAAGACTAAGTTCAG -3'
(R):5'- GTGAGTGTTCACGGCACTGTAC -3'

Sequencing Primer
(F):5'- CACCATTGCCATGTTTGAT -3'
(R):5'- GTGTTCACGGCACTGTACAAAGC -3'
Posted On2017-02-10