Incidental Mutation 'R5862:Pja2'
ID453986
Institutional Source Beutler Lab
Gene Symbol Pja2
Ensembl Gene ENSMUSG00000024083
Gene Namepraja ring finger ubiquitin ligase 2
SynonymsNeurodap1
MMRRC Submission 043231-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R5862 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location64281005-64331916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64297826 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 454 (D454G)
Ref Sequence ENSEMBL: ENSMUSP00000134380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024888] [ENSMUST00000024889] [ENSMUST00000172733] [ENSMUST00000172818]
Predicted Effect probably benign
Transcript: ENSMUST00000024888
AA Change: D454G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000024888
Gene: ENSMUSG00000024083
AA Change: D454G

DomainStartEndE-ValueType
low complexity region 532 548 N/A INTRINSIC
RING 633 673 3.84e-6 SMART
low complexity region 678 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000024889
SMART Domains Protein: ENSMUSP00000024889
Gene: ENSMUSG00000024083

DomainStartEndE-ValueType
low complexity region 470 486 N/A INTRINSIC
RING 571 611 3.84e-6 SMART
low complexity region 616 641 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172733
SMART Domains Protein: ENSMUSP00000133730
Gene: ENSMUSG00000024083

DomainStartEndE-ValueType
low complexity region 470 486 N/A INTRINSIC
RING 571 611 3.84e-6 SMART
low complexity region 616 641 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172818
AA Change: D454G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134380
Gene: ENSMUSG00000024083
AA Change: D454G

DomainStartEndE-ValueType
low complexity region 532 548 N/A INTRINSIC
RING 633 673 3.84e-6 SMART
low complexity region 678 703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 A G 1: 179,788,330 Y326H probably damaging Het
Alpk2 T A 18: 65,307,289 K811N probably damaging Het
Ap3b1 T A 13: 94,547,770 M1014K unknown Het
Bphl G A 13: 34,063,984 V247I possibly damaging Het
C6 A T 15: 4,735,263 D147V possibly damaging Het
Clec18a G A 8: 111,081,558 H71Y possibly damaging Het
Cse1l A G 2: 166,915,207 T10A probably benign Het
Cyp2b9 G T 7: 26,187,807 G214C probably benign Het
Dctn6 A T 8: 34,108,417 probably null Het
Dnaja4 G T 9: 54,699,341 probably benign Het
Dpp8 A T 9: 65,045,722 S227C probably benign Het
Ecel1 T C 1: 87,149,596 N630S probably benign Het
Etnppl T C 3: 130,631,824 V426A possibly damaging Het
Golgb1 A T 16: 36,926,091 silent Het
H2afy T A 13: 56,074,271 I359L probably damaging Het
Hapln3 A T 7: 79,121,891 H83Q possibly damaging Het
Hmgxb4 A G 8: 75,001,055 K222R probably damaging Het
Hsf5 C A 11: 87,622,991 T294K probably damaging Het
Ighv12-2 A G 12: 114,127,937 noncoding transcript Het
Lrch3 A T 16: 32,995,809 H587L probably damaging Het
Mboat1 C T 13: 30,235,697 T339M probably damaging Het
Mief1 G A 15: 80,248,385 R156Q probably benign Het
Ms4a6b T A 19: 11,521,803 F94I probably benign Het
Neb T A 2: 52,179,542 R307* probably null Het
Neu4 A G 1: 94,022,930 I147V probably benign Het
Olfr1036 T C 2: 86,075,646 I302T probably benign Het
Pcyox1 A G 6: 86,391,674 probably null Het
Pik3ap1 T A 19: 41,332,345 D145V probably damaging Het
Plekhg1 C T 10: 3,937,914 T281M probably damaging Het
Ptprq T C 10: 107,565,878 I1918V probably benign Het
Rasgef1a A C 6: 118,080,444 R35S probably benign Het
Rnf167 A G 11: 70,651,092 T308A probably damaging Het
Sfmbt2 C T 2: 10,402,052 T54I possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Shkbp1 G T 7: 27,343,404 S536* probably null Het
Taf2 C A 15: 55,048,323 V566L possibly damaging Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tyms A T 5: 30,063,410 D97E probably damaging Het
Usp20 T A 2: 31,006,449 L188* probably null Het
Zbtb10 T A 3: 9,265,216 S545T probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Pja2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Pja2 APN 17 64283531 missense probably damaging 1.00
IGL00945:Pja2 APN 17 64309396 missense probably benign 0.00
IGL01347:Pja2 APN 17 64313028 missense probably benign 0.34
IGL01831:Pja2 APN 17 64309407 missense probably benign 0.02
IGL01977:Pja2 APN 17 64297826 missense probably benign 0.02
IGL02812:Pja2 APN 17 64297794 missense probably damaging 1.00
H8441:Pja2 UTSW 17 64311197 missense probably damaging 1.00
R0062:Pja2 UTSW 17 64308971 missense probably damaging 1.00
R0062:Pja2 UTSW 17 64308971 missense probably damaging 1.00
R0411:Pja2 UTSW 17 64287521 splice site probably benign
R1240:Pja2 UTSW 17 64309618 missense probably benign 0.00
R1528:Pja2 UTSW 17 64309222 missense possibly damaging 0.75
R1996:Pja2 UTSW 17 64287644 critical splice acceptor site probably null
R2111:Pja2 UTSW 17 64290036 missense probably damaging 1.00
R2162:Pja2 UTSW 17 64309402 missense probably benign 0.00
R2201:Pja2 UTSW 17 64311167 splice site probably benign
R2276:Pja2 UTSW 17 64292870 missense probably damaging 1.00
R2278:Pja2 UTSW 17 64292870 missense probably damaging 1.00
R3831:Pja2 UTSW 17 64309402 missense probably benign 0.00
R3833:Pja2 UTSW 17 64309402 missense probably benign 0.00
R4598:Pja2 UTSW 17 64313030 start codon destroyed probably null 0.69
R4801:Pja2 UTSW 17 64292862 missense probably damaging 1.00
R4802:Pja2 UTSW 17 64292862 missense probably damaging 1.00
R4983:Pja2 UTSW 17 64309058 missense probably benign 0.00
R5634:Pja2 UTSW 17 64292867 missense probably damaging 1.00
R5905:Pja2 UTSW 17 64309090 missense probably benign 0.26
R6028:Pja2 UTSW 17 64309090 missense probably benign 0.26
R6382:Pja2 UTSW 17 64309615 missense probably benign 0.07
R6650:Pja2 UTSW 17 64292941 missense probably damaging 1.00
R6725:Pja2 UTSW 17 64289967 missense probably damaging 1.00
R6976:Pja2 UTSW 17 64308959 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTTCAACATGGGCTCC -3'
(R):5'- TGACTCAACGTAGGCATCAGC -3'

Sequencing Primer
(F):5'- TGGGCTCCTACATATAATCAAGGGC -3'
(R):5'- GTAGGCATCAGCAGTCCTACCTAG -3'
Posted On2017-02-10