Incidental Mutation 'R5864:Zfp341'
ID454046
Institutional Source Beutler Lab
Gene Symbol Zfp341
Ensembl Gene ENSMUSG00000059842
Gene Namezinc finger protein 341
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5864 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location154613297-154646821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 154643554 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 637 (H637N)
Ref Sequence ENSEMBL: ENSMUSP00000080596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081926] [ENSMUST00000109702] [ENSMUST00000126421]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081926
AA Change: H637N

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080596
Gene: ENSMUSG00000059842
AA Change: H637N

DomainStartEndE-ValueType
ZnF_C2H2 53 73 4.16e1 SMART
low complexity region 96 110 N/A INTRINSIC
low complexity region 154 161 N/A INTRINSIC
low complexity region 177 200 N/A INTRINSIC
ZnF_C2H2 320 342 3.69e-4 SMART
ZnF_C2H2 348 370 1.04e-3 SMART
ZnF_C2H2 442 464 1.45e-2 SMART
ZnF_C2H2 470 494 2.17e-1 SMART
ZnF_C2H2 500 522 2.91e-2 SMART
ZnF_C2H2 537 561 1.23e0 SMART
ZnF_C2H2 563 585 3.58e-2 SMART
ZnF_C2H2 591 613 1.62e0 SMART
ZnF_C2H2 619 641 2.27e-4 SMART
ZnF_C2H2 647 674 7.29e0 SMART
ZnF_C2H2 680 702 5.14e-3 SMART
low complexity region 740 759 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109702
AA Change: H630N

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105324
Gene: ENSMUSG00000059842
AA Change: H630N

DomainStartEndE-ValueType
ZnF_C2H2 53 73 4.16e1 SMART
low complexity region 96 110 N/A INTRINSIC
low complexity region 154 161 N/A INTRINSIC
low complexity region 177 200 N/A INTRINSIC
ZnF_C2H2 313 335 3.69e-4 SMART
ZnF_C2H2 341 363 1.04e-3 SMART
ZnF_C2H2 435 457 1.45e-2 SMART
ZnF_C2H2 463 487 2.17e-1 SMART
ZnF_C2H2 493 515 2.91e-2 SMART
ZnF_C2H2 530 554 1.23e0 SMART
ZnF_C2H2 556 578 3.58e-2 SMART
ZnF_C2H2 584 606 1.62e0 SMART
ZnF_C2H2 612 634 2.27e-4 SMART
ZnF_C2H2 640 667 7.29e0 SMART
ZnF_C2H2 673 695 5.14e-3 SMART
low complexity region 733 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126421
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 A T 12: 84,043,404 I292F probably benign Het
Adamdec1 A G 14: 68,570,102 S370P probably damaging Het
Ankar T C 1: 72,659,165 K692R probably benign Het
Ano6 T C 15: 95,920,380 probably null Het
Apopt1 G A 12: 111,751,218 V171I probably benign Het
Asns G A 6: 7,675,443 Q520* probably null Het
Bbs12 C T 3: 37,319,490 T144I probably damaging Het
BC030867 G A 11: 102,255,146 E83K probably benign Het
C8g C T 2: 25,498,943 G186D probably damaging Het
Clptm1l T C 13: 73,606,284 F109S probably damaging Het
Col4a1 G A 8: 11,202,973 probably benign Het
Cpn2 T C 16: 30,259,683 D400G probably damaging Het
Dgke G C 11: 89,050,462 Y298* probably null Het
Dnah5 G A 15: 28,297,013 R1451Q possibly damaging Het
Dock8 A G 19: 25,061,220 D90G probably damaging Het
Dok7 A C 5: 35,066,546 D143A probably damaging Het
Elk3 G A 10: 93,284,791 A62V probably damaging Het
Epha2 T A 4: 141,308,427 M58K probably damaging Het
Erp27 G T 6: 136,908,100 D233E probably benign Het
Gm5174 T A 10: 86,657,181 noncoding transcript Het
Gxylt2 A G 6: 100,783,146 D214G probably damaging Het
Ifi35 A T 11: 101,458,243 I238F probably damaging Het
Ighmbp2 T C 19: 3,261,467 T983A probably benign Het
Itgb4 C T 11: 115,990,922 R766W probably damaging Het
Lrp1 C A 10: 127,567,505 K2066N possibly damaging Het
Mansc1 T G 6: 134,610,853 probably null Het
Mapre3 T C 5: 30,863,238 F101S probably damaging Het
Mettl8 T C 2: 70,982,013 T58A probably benign Het
Mical1 G T 10: 41,486,068 R857L possibly damaging Het
Nacad T C 11: 6,600,581 D870G probably benign Het
Nectin1 A G 9: 43,791,310 D118G probably damaging Het
Nlrp2 A T 7: 5,322,381 L26Q probably damaging Het
Olfr512 A G 7: 108,713,464 D25G probably benign Het
Pamr1 T C 2: 102,634,348 S281P possibly damaging Het
Pcdhgc5 T A 18: 37,821,761 V696E probably damaging Het
Pde4d G T 13: 109,938,048 A396S probably benign Het
Pecam1 G T 11: 106,684,250 C510* probably null Het
Pga5 C T 19: 10,675,149 G76S probably damaging Het
Phldb3 A T 7: 24,624,146 H435L possibly damaging Het
Piezo1 T C 8: 122,486,373 R1884G possibly damaging Het
Ripk4 T C 16: 97,763,582 H43R probably damaging Het
Rtn3 A G 19: 7,435,111 V785A probably damaging Het
Safb2 A G 17: 56,566,491 probably benign Het
Sephs1 T C 2: 4,905,582 F288L probably damaging Het
Sez6l A G 5: 112,438,400 probably null Het
Siglece A G 7: 43,659,317 L204P probably damaging Het
Sis T C 3: 72,949,818 D380G probably damaging Het
Slamf9 G T 1: 172,476,466 R126L probably benign Het
Sorl1 A G 9: 42,092,373 L209P probably damaging Het
Sptbn1 A C 11: 30,145,925 I310S probably damaging Het
Tex52 A G 6: 128,379,682 T113A probably benign Het
Trav6-3 T A 14: 53,430,171 Y33* probably null Het
Vmn2r102 A G 17: 19,694,681 E836G possibly damaging Het
Wdsub1 C T 2: 59,878,475 C18Y probably damaging Het
Zfp445 C T 9: 122,853,487 S463N probably benign Het
Zfp612 G A 8: 110,089,726 D522N probably damaging Het
Other mutations in Zfp341
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Zfp341 APN 2 154634231 missense probably damaging 1.00
IGL01352:Zfp341 APN 2 154628896 missense probably benign 0.00
IGL01748:Zfp341 APN 2 154628927 missense probably damaging 0.99
IGL02260:Zfp341 APN 2 154642049 missense possibly damaging 0.89
IGL02329:Zfp341 APN 2 154632304 missense possibly damaging 0.90
casanova_grimbacher UTSW 2 154624881 missense probably damaging 1.00
specious UTSW 2 154646134 missense possibly damaging 0.63
R0079:Zfp341 UTSW 2 154624994 nonsense probably null
R0570:Zfp341 UTSW 2 154646068 missense probably benign 0.02
R0620:Zfp341 UTSW 2 154634273 missense possibly damaging 0.94
R1018:Zfp341 UTSW 2 154646052 missense probably damaging 1.00
R1611:Zfp341 UTSW 2 154645703 missense probably damaging 1.00
R1733:Zfp341 UTSW 2 154641378 missense probably benign 0.19
R1822:Zfp341 UTSW 2 154646134 missense possibly damaging 0.63
R1956:Zfp341 UTSW 2 154638212 missense probably benign 0.09
R2437:Zfp341 UTSW 2 154628801 missense probably damaging 0.97
R3623:Zfp341 UTSW 2 154624881 missense probably damaging 1.00
R4417:Zfp341 UTSW 2 154628987 missense possibly damaging 0.94
R4806:Zfp341 UTSW 2 154645866 utr 3 prime probably benign
R4807:Zfp341 UTSW 2 154645866 utr 3 prime probably benign
R4863:Zfp341 UTSW 2 154645866 utr 3 prime probably benign
R4955:Zfp341 UTSW 2 154638030 missense probably damaging 0.98
R4962:Zfp341 UTSW 2 154626814 missense possibly damaging 0.80
R5484:Zfp341 UTSW 2 154625001 missense probably benign 0.00
R5877:Zfp341 UTSW 2 154632289 missense probably damaging 1.00
R5975:Zfp341 UTSW 2 154630441 missense probably damaging 1.00
R5990:Zfp341 UTSW 2 154645659 missense probably damaging 0.98
R6057:Zfp341 UTSW 2 154625034 missense probably benign 0.01
R6882:Zfp341 UTSW 2 154638023 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTATGCCAAGTCAGGAAG -3'
(R):5'- TGTGCATCCTGGAACCCAAAG -3'

Sequencing Primer
(F):5'- CCCTATGCCAAGTCAGGAAGAATAAG -3'
(R):5'- CCCAAAGCCATCAGTTAATTAGGTG -3'
Posted On2017-02-10