Incidental Mutation 'R5864:Asns'
ID454056
Institutional Source Beutler Lab
Gene Symbol Asns
Ensembl Gene ENSMUSG00000029752
Gene Nameasparagine synthetase
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.875) question?
Stock #R5864 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location7675169-7693254 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 7675443 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 520 (Q520*)
Ref Sequence ENSEMBL: ENSMUSP00000111204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031766] [ENSMUST00000115542]
Predicted Effect probably null
Transcript: ENSMUST00000031766
AA Change: Q520*
SMART Domains Protein: ENSMUSP00000031766
Gene: ENSMUSG00000029752
AA Change: Q520*

DomainStartEndE-ValueType
Pfam:GATase_6 29 160 4.3e-21 PFAM
Pfam:GATase_7 47 166 9.1e-26 PFAM
Pfam:DUF3700 68 178 5.5e-6 PFAM
Pfam:GATase_2 91 161 3.3e-5 PFAM
Pfam:Asn_synthase 234 467 1.7e-61 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115542
AA Change: Q520*
SMART Domains Protein: ENSMUSP00000111204
Gene: ENSMUSG00000029752
AA Change: Q520*

DomainStartEndE-ValueType
Pfam:GATase_6 29 160 1.2e-19 PFAM
Pfam:GATase_7 47 166 4.8e-25 PFAM
Pfam:DUF3700 64 180 3.3e-6 PFAM
Pfam:Asn_synthase 234 390 2.4e-46 PFAM
Pfam:Asn_synthase 382 547 1.5e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140097
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the synthesis of asparagine. This gene complements a mutation in the temperature-sensitive hamster mutant ts11, which blocks progression through the G1 phase of the cell cycle at nonpermissive temperature. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a hypomophic allele exhibit structural brain abnormalities, including enlarged ventricles and reduced cortical thickness, and deficits in short- and long-term memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 A T 12: 84,043,404 I292F probably benign Het
Adamdec1 A G 14: 68,570,102 S370P probably damaging Het
Ankar T C 1: 72,659,165 K692R probably benign Het
Ano6 T C 15: 95,920,380 probably null Het
Apopt1 G A 12: 111,751,218 V171I probably benign Het
Bbs12 C T 3: 37,319,490 T144I probably damaging Het
BC030867 G A 11: 102,255,146 E83K probably benign Het
C8g C T 2: 25,498,943 G186D probably damaging Het
Clptm1l T C 13: 73,606,284 F109S probably damaging Het
Col4a1 G A 8: 11,202,973 probably benign Het
Cpn2 T C 16: 30,259,683 D400G probably damaging Het
Dgke G C 11: 89,050,462 Y298* probably null Het
Dnah5 G A 15: 28,297,013 R1451Q possibly damaging Het
Dock8 A G 19: 25,061,220 D90G probably damaging Het
Dok7 A C 5: 35,066,546 D143A probably damaging Het
Elk3 G A 10: 93,284,791 A62V probably damaging Het
Epha2 T A 4: 141,308,427 M58K probably damaging Het
Erp27 G T 6: 136,908,100 D233E probably benign Het
Gm5174 T A 10: 86,657,181 noncoding transcript Het
Gxylt2 A G 6: 100,783,146 D214G probably damaging Het
Ifi35 A T 11: 101,458,243 I238F probably damaging Het
Ighmbp2 T C 19: 3,261,467 T983A probably benign Het
Itgb4 C T 11: 115,990,922 R766W probably damaging Het
Lrp1 C A 10: 127,567,505 K2066N possibly damaging Het
Mansc1 T G 6: 134,610,853 probably null Het
Mapre3 T C 5: 30,863,238 F101S probably damaging Het
Mettl8 T C 2: 70,982,013 T58A probably benign Het
Mical1 G T 10: 41,486,068 R857L possibly damaging Het
Nacad T C 11: 6,600,581 D870G probably benign Het
Nectin1 A G 9: 43,791,310 D118G probably damaging Het
Nlrp2 A T 7: 5,322,381 L26Q probably damaging Het
Olfr512 A G 7: 108,713,464 D25G probably benign Het
Pamr1 T C 2: 102,634,348 S281P possibly damaging Het
Pcdhgc5 T A 18: 37,821,761 V696E probably damaging Het
Pde4d G T 13: 109,938,048 A396S probably benign Het
Pecam1 G T 11: 106,684,250 C510* probably null Het
Pga5 C T 19: 10,675,149 G76S probably damaging Het
Phldb3 A T 7: 24,624,146 H435L possibly damaging Het
Piezo1 T C 8: 122,486,373 R1884G possibly damaging Het
Ripk4 T C 16: 97,763,582 H43R probably damaging Het
Rtn3 A G 19: 7,435,111 V785A probably damaging Het
Safb2 A G 17: 56,566,491 probably benign Het
Sephs1 T C 2: 4,905,582 F288L probably damaging Het
Sez6l A G 5: 112,438,400 probably null Het
Siglece A G 7: 43,659,317 L204P probably damaging Het
Sis T C 3: 72,949,818 D380G probably damaging Het
Slamf9 G T 1: 172,476,466 R126L probably benign Het
Sorl1 A G 9: 42,092,373 L209P probably damaging Het
Sptbn1 A C 11: 30,145,925 I310S probably damaging Het
Tex52 A G 6: 128,379,682 T113A probably benign Het
Trav6-3 T A 14: 53,430,171 Y33* probably null Het
Vmn2r102 A G 17: 19,694,681 E836G possibly damaging Het
Wdsub1 C T 2: 59,878,475 C18Y probably damaging Het
Zfp341 C A 2: 154,643,554 H637N possibly damaging Het
Zfp445 C T 9: 122,853,487 S463N probably benign Het
Zfp612 G A 8: 110,089,726 D522N probably damaging Het
Other mutations in Asns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Asns APN 6 7680179 missense probably damaging 1.00
IGL00656:Asns APN 6 7680215 unclassified probably benign
IGL01534:Asns APN 6 7675397 missense probably benign 0.03
IGL01996:Asns APN 6 7682378 missense possibly damaging 0.56
IGL02058:Asns APN 6 7685184 missense probably damaging 1.00
IGL02311:Asns APN 6 7676233 critical splice donor site probably null
IGL02367:Asns APN 6 7685411 splice site probably benign
IGL03263:Asns APN 6 7689404 missense probably benign 0.07
IGL03341:Asns APN 6 7682002 missense probably damaging 0.98
PIT4445001:Asns UTSW 6 7689277 missense probably damaging 1.00
R0034:Asns UTSW 6 7676299 missense probably damaging 1.00
R0034:Asns UTSW 6 7676299 missense probably damaging 1.00
R0050:Asns UTSW 6 7676019 missense probably benign 0.02
R0627:Asns UTSW 6 7675516 missense probably benign 0.05
R1075:Asns UTSW 6 7676076 nonsense probably null
R1591:Asns UTSW 6 7678007 missense probably damaging 0.97
R2047:Asns UTSW 6 7680093 missense probably damaging 0.99
R2232:Asns UTSW 6 7689316 missense possibly damaging 0.82
R2907:Asns UTSW 6 7675506 missense probably benign 0.03
R3907:Asns UTSW 6 7682270 critical splice donor site probably null
R4373:Asns UTSW 6 7677978 missense probably damaging 0.98
R4438:Asns UTSW 6 7675320 missense probably benign 0.15
R4660:Asns UTSW 6 7678012 missense probably benign 0.05
R4784:Asns UTSW 6 7678029 missense probably benign 0.12
R5655:Asns UTSW 6 7685309 missense probably benign 0.31
R5752:Asns UTSW 6 7689365 missense probably damaging 1.00
R5863:Asns UTSW 6 7675443 nonsense probably null
R5953:Asns UTSW 6 7682285 missense probably benign 0.00
R6773:Asns UTSW 6 7676284 missense probably benign 0.01
R6789:Asns UTSW 6 7675344 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACTGATGGCTGAGTCTCATTC -3'
(R):5'- CGTAAAGGGTCTTGTTGCTTCATAG -3'

Sequencing Primer
(F):5'- GCTGTCTCGACCTTCAGAG -3'
(R):5'- TTTGGTCACCATCAGAGC -3'
Posted On2017-02-10