Incidental Mutation 'R5865:Myo5c'
ID454128
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Namemyosin VC
Synonyms9130003O20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R5865 (G1)
Quality Score214
Status Validated
Chromosome9
Chromosomal Location75232020-75305451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75297488 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1541 (D1541G)
Ref Sequence ENSEMBL: ENSMUSP00000042229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555]
Predicted Effect probably damaging
Transcript: ENSMUST00000036555
AA Change: D1541G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590
AA Change: D1541G

DomainStartEndE-ValueType
MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216529
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.7%
  • 20x: 88.7%
Validation Efficiency 91% (59/65)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6a G A 3: 32,712,128 V48M possibly damaging Het
Adamts2 T G 11: 50,803,954 Y1189* probably null Het
Bpifb9a T C 2: 154,266,836 I419T probably benign Het
Ccbe1 A T 18: 66,083,151 I167N possibly damaging Het
Ccdc187 T C 2: 26,293,368 T207A probably benign Het
Cd300lf G A 11: 115,126,300 L66F probably damaging Het
Cenpk A G 13: 104,236,194 *92W probably null Het
Col12a1 A T 9: 79,604,478 S2950R probably benign Het
Dnah3 T C 7: 119,975,108 T2154A probably benign Het
Ebna1bp2 A T 4: 118,621,135 probably benign Het
Elac2 G T 11: 64,997,957 C532F probably benign Het
Fam171a1 T A 2: 3,225,337 D377E probably benign Het
Haus6 A G 4: 86,586,357 C466R possibly damaging Het
Il4ra T C 7: 125,575,176 S297P probably benign Het
Itgb4 C T 11: 115,990,922 R766W probably damaging Het
Kank4 T C 4: 98,771,393 Y816C possibly damaging Het
Kcnc4 A T 3: 107,458,199 probably null Het
Kif21b C T 1: 136,151,137 R408* probably null Het
Lrrc31 A G 3: 30,679,140 V475A probably benign Het
Map2k1 C T 9: 64,191,266 probably null Het
Mc3r T A 2: 172,249,672 N271K possibly damaging Het
Ms4a14 A G 19: 11,304,217 S326P possibly damaging Het
Muc6 T A 7: 141,650,504 I358F probably damaging Het
Myof T C 19: 37,910,934 S1793G probably damaging Het
Nfkb1 T A 3: 135,603,780 T518S probably damaging Het
Nphs1 T A 7: 30,474,385 I989N probably damaging Het
Olfr1024 T C 2: 85,904,521 T178A probably benign Het
Pcdha5 T C 18: 36,961,421 F328L probably benign Het
Pclo T A 5: 14,714,478 S4322T probably benign Het
Peg10 A G 6: 4,754,375 N52S probably damaging Het
Phf10 A C 17: 14,955,010 probably benign Het
Psme4 T C 11: 30,791,993 I152T possibly damaging Het
Ptpn18 T A 1: 34,471,563 probably benign Het
Rufy4 A T 1: 74,146,755 Y527F probably damaging Het
Snx32 T C 19: 5,496,354 M293V probably benign Het
Sorl1 A T 9: 41,983,034 L1827M possibly damaging Het
Sstr5 T A 17: 25,491,244 D337V probably benign Het
Tcaf3 A G 6: 42,596,697 F194L probably benign Het
Tcerg1 T A 18: 42,536,348 W459R probably damaging Het
Tet2 T A 3: 133,487,099 I525L probably benign Het
Tmem55b A G 14: 50,928,875 probably benign Het
Trim43b C T 9: 89,085,606 V325I probably benign Het
Txndc11 A T 16: 11,122,688 I180K probably damaging Het
Vmn1r193 A G 13: 22,219,225 L199P probably damaging Het
Vmn2r110 A G 17: 20,584,295 M121T probably benign Het
Zfhx4 G C 3: 5,402,659 A2626P probably damaging Het
Zfp445 C T 9: 122,853,487 S463N probably benign Het
Zwilch T A 9: 64,172,908 probably null Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75242880 splice site probably benign
IGL00848:Myo5c APN 9 75289181 missense probably benign
IGL01503:Myo5c APN 9 75263042 missense probably damaging 1.00
IGL01735:Myo5c APN 9 75301438 missense probably damaging 1.00
IGL01866:Myo5c APN 9 75269582 missense probably benign 0.00
IGL01956:Myo5c APN 9 75242876 splice site probably null
IGL02127:Myo5c APN 9 75300902 missense probably damaging 1.00
IGL02268:Myo5c APN 9 75246237 missense probably damaging 1.00
IGL02272:Myo5c APN 9 75266160 missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75252516 splice site probably benign
IGL03179:Myo5c APN 9 75255866 missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75278243 missense probably benign 0.01
PIT4142001:Myo5c UTSW 9 75283948 missense probably benign 0.00
R0126:Myo5c UTSW 9 75269525 missense probably benign 0.05
R0266:Myo5c UTSW 9 75284216 splice site probably benign
R0345:Myo5c UTSW 9 75297419 missense probably damaging 1.00
R0387:Myo5c UTSW 9 75285021 splice site probably benign
R0602:Myo5c UTSW 9 75266196 splice site probably null
R0675:Myo5c UTSW 9 75278289 missense probably benign
R0798:Myo5c UTSW 9 75257984 missense probably damaging 1.00
R0981:Myo5c UTSW 9 75271591 missense probably damaging 1.00
R1051:Myo5c UTSW 9 75290883 missense probably benign 0.00
R1072:Myo5c UTSW 9 75292208 missense probably damaging 1.00
R1144:Myo5c UTSW 9 75286448 missense probably damaging 1.00
R1454:Myo5c UTSW 9 75263066 missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75275939 missense probably damaging 1.00
R1484:Myo5c UTSW 9 75300810 missense probably damaging 1.00
R1586:Myo5c UTSW 9 75267031 missense probably damaging 0.99
R1616:Myo5c UTSW 9 75296017 missense probably damaging 1.00
R1635:Myo5c UTSW 9 75277075 missense probably benign 0.09
R1800:Myo5c UTSW 9 75246164 missense probably damaging 1.00
R1838:Myo5c UTSW 9 75273553 missense probably damaging 1.00
R1840:Myo5c UTSW 9 75249735 missense probably damaging 1.00
R1885:Myo5c UTSW 9 75249761 missense probably damaging 1.00
R1897:Myo5c UTSW 9 75292241 missense probably benign 0.20
R1898:Myo5c UTSW 9 75297626 missense probably damaging 1.00
R2029:Myo5c UTSW 9 75289055 unclassified probably benign
R2063:Myo5c UTSW 9 75281868 missense probably benign 0.19
R2230:Myo5c UTSW 9 75273606 missense probably benign
R2519:Myo5c UTSW 9 75250436 missense probably damaging 1.00
R2520:Myo5c UTSW 9 75297649 nonsense probably null
R3034:Myo5c UTSW 9 75286577 missense probably benign 0.44
R3117:Myo5c UTSW 9 75266194 critical splice donor site probably null
R3432:Myo5c UTSW 9 75263001 missense probably damaging 1.00
R3751:Myo5c UTSW 9 75276002 missense probably damaging 1.00
R4132:Myo5c UTSW 9 75252568 missense probably benign 0.00
R4173:Myo5c UTSW 9 75246258 missense probably damaging 1.00
R4239:Myo5c UTSW 9 75283942 missense probably benign 0.01
R4429:Myo5c UTSW 9 75294001 missense probably damaging 1.00
R4574:Myo5c UTSW 9 75269611 missense probably benign 0.00
R4791:Myo5c UTSW 9 75290916 missense probably damaging 1.00
R4804:Myo5c UTSW 9 75245024 missense probably damaging 1.00
R4819:Myo5c UTSW 9 75292202 missense probably damaging 0.97
R4881:Myo5c UTSW 9 75284152 missense probably benign 0.00
R4900:Myo5c UTSW 9 75273543 missense probably damaging 1.00
R4964:Myo5c UTSW 9 75297509 missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75269596 missense probably benign 0.03
R5057:Myo5c UTSW 9 75300873 missense probably damaging 1.00
R5347:Myo5c UTSW 9 75295205 missense probably null 1.00
R5399:Myo5c UTSW 9 75288074 missense possibly damaging 0.80
R5440:Myo5c UTSW 9 75258125 missense possibly damaging 0.91
R5569:Myo5c UTSW 9 75273510 missense probably damaging 1.00
R5600:Myo5c UTSW 9 75289154 missense probably benign 0.00
R5606:Myo5c UTSW 9 75275508 missense probably damaging 1.00
R5704:Myo5c UTSW 9 75272903 missense probably benign 0.00
R5798:Myo5c UTSW 9 75284198 missense probably benign 0.04
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6143:Myo5c UTSW 9 75249809 missense probably damaging 1.00
R6242:Myo5c UTSW 9 75273611 missense probably benign
R6253:Myo5c UTSW 9 75245037 missense probably damaging 1.00
R6264:Myo5c UTSW 9 75275554 missense probably benign
R6307:Myo5c UTSW 9 75272916 missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75296012 missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75286578 missense probably benign 0.26
R6598:Myo5c UTSW 9 75246234 missense probably damaging 1.00
R6618:Myo5c UTSW 9 75275637 critical splice donor site probably null
R6774:Myo5c UTSW 9 75289186 missense probably benign 0.05
R6865:Myo5c UTSW 9 75269596 missense probably benign 0.03
Z1088:Myo5c UTSW 9 75245059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCCACTGACTATGAGCAAAG -3'
(R):5'- GGAGCATTTCTTCCAGCTGG -3'

Sequencing Primer
(F):5'- TGACTATGAGCAAAGACACCTG -3'
(R):5'- ATGCCTTTCCTGCAGGAGC -3'
Posted On2017-02-10