Incidental Mutation 'R5866:Slc24a5'
ID454158
Institutional Source Beutler Lab
Gene Symbol Slc24a5
Ensembl Gene ENSMUSG00000035183
Gene Namesolute carrier family 24, member 5
SynonymsOca6, NCX5, F630045L20Rik, NCKX5
MMRRC Submission 044075-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5866 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location125068124-125088677 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 125085671 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 297 (F297I)
Ref Sequence ENSEMBL: ENSMUSP00000063887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067780] [ENSMUST00000070353] [ENSMUST00000110501] [ENSMUST00000142718] [ENSMUST00000147105] [ENSMUST00000152367]
Predicted Effect probably benign
Transcript: ENSMUST00000067780
SMART Domains Protein: ENSMUSP00000066312
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 430 450 N/A INTRINSIC
RRM 498 569 6.15e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000070353
AA Change: F297I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063887
Gene: ENSMUSG00000035183
AA Change: F297I

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Na_Ca_ex 72 216 1.1e-24 PFAM
low complexity region 274 290 N/A INTRINSIC
low complexity region 311 324 N/A INTRINSIC
Pfam:Na_Ca_ex 334 485 7.6e-31 PFAM
low complexity region 488 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089825
SMART Domains Protein: ENSMUSP00000087258
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 48 121 1.84e-22 SMART
low complexity region 154 167 N/A INTRINSIC
RRM 181 253 5.12e-21 SMART
low complexity region 274 291 N/A INTRINSIC
low complexity region 386 406 N/A INTRINSIC
RRM 454 525 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110501
SMART Domains Protein: ENSMUSP00000106127
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 430 450 N/A INTRINSIC
RRM 498 569 6.15e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139615
Predicted Effect probably benign
Transcript: ENSMUST00000142718
SMART Domains Protein: ENSMUSP00000115519
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 351 376 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
RRM 491 562 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147105
SMART Domains Protein: ENSMUSP00000114817
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
RRM 474 545 6.15e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149963
Predicted Effect probably benign
Transcript: ENSMUST00000152367
SMART Domains Protein: ENSMUSP00000123088
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 351 376 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
RRM 515 586 6.15e-24 SMART
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.7%
Validation Efficiency 91% (51/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the potassium-dependent sodium/calcium exchanger family and encodes an intracellular membrane protein with 2 large hydrophilic loops and 2 sets of multiple transmembrane-spanning segments. Sequence variation in this gene has been associated with differences in skin pigmentation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypopigmentation and ocular albinism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,169,084 probably benign Het
A530084C06Rik G A 13: 31,559,195 A25V unknown Het
A730018C14Rik T C 12: 112,415,038 noncoding transcript Het
Aasdh G T 5: 76,876,211 A198E probably damaging Het
Abcb8 C T 5: 24,402,103 A328V probably damaging Het
Ace3 C A 11: 105,997,504 H347N probably damaging Het
Amy1 A T 3: 113,561,920 M302K possibly damaging Het
Apol11b C T 15: 77,640,547 V13M probably null Het
Arfgef2 T A 2: 166,836,257 V131E possibly damaging Het
Arnt T A 3: 95,490,726 probably benign Het
Atl1 T C 12: 69,926,011 V35A probably damaging Het
BC061237 A T 14: 44,501,273 D43V possibly damaging Het
C530008M17Rik A G 5: 76,857,537 T582A unknown Het
Cyp4f17 T C 17: 32,506,913 S7P probably benign Het
Ddx60 A G 8: 61,940,740 Y70C probably damaging Het
Defb34 T C 8: 19,126,452 L53P probably damaging Het
Dennd5a T C 7: 109,919,360 T525A probably benign Het
Ephb3 T C 16: 21,211,379 probably benign Het
Fam83d T A 2: 158,779,830 probably null Het
Gramd3 A G 18: 56,474,036 D74G possibly damaging Het
Hax1 A G 3: 89,995,728 probably benign Het
Kcnh8 T C 17: 52,956,776 I767T probably benign Het
Ldah G A 12: 8,220,614 V5I possibly damaging Het
Nbeal2 A G 9: 110,631,492 V1758A probably damaging Het
Nos1 A G 5: 117,895,902 D363G probably damaging Het
Olfr127 C T 17: 37,903,809 R88* probably null Het
Pdlim7 T A 13: 55,498,688 D445V probably damaging Het
Phip T A 9: 82,890,150 M1115L probably benign Het
Pigb C T 9: 73,029,684 A215T probably damaging Het
Pkd1 A T 17: 24,580,961 S2952C probably damaging Het
Plxnb2 T C 15: 89,167,572 D148G probably damaging Het
Ppp1r36 T C 12: 76,426,805 F70S possibly damaging Het
Rad52 G A 6: 119,912,946 probably benign Het
Rasa2 T A 9: 96,545,770 T681S probably benign Het
Rel A T 11: 23,742,724 Y436* probably null Het
Sec16a G A 2: 26,419,638 P2119S probably benign Het
Sema6d C A 2: 124,664,342 T733K probably benign Het
Sf3b3 C T 8: 110,814,634 A950T probably benign Het
Spp2 A T 1: 88,412,303 D122V possibly damaging Het
Stap1 A G 5: 86,078,047 K60R probably benign Het
Stat1 A G 1: 52,139,264 K286E probably damaging Het
Stn1 T C 19: 47,517,129 T129A probably benign Het
Tagap C T 17: 7,933,453 T490I probably damaging Het
Tbc1d2 T C 4: 46,637,715 E177G possibly damaging Het
Tln2 A T 9: 67,266,868 L841Q probably damaging Het
Tmem59 T A 4: 107,190,557 M71K probably damaging Het
Ugt2a3 G A 5: 87,336,547 T206I probably damaging Het
Utp20 G A 10: 88,772,559 H1539Y possibly damaging Het
Vps13a T C 19: 16,680,023 N1794S probably benign Het
Vsig10 A T 5: 117,352,749 probably null Het
Zfp97 T A 17: 17,144,825 F195L possibly damaging Het
Other mutations in Slc24a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Slc24a5 APN 2 125080889 missense probably damaging 1.00
IGL01307:Slc24a5 APN 2 125080880 missense probably damaging 1.00
IGL01926:Slc24a5 APN 2 125068903 missense probably benign 0.01
IGL02090:Slc24a5 APN 2 125068298 missense probably benign 0.25
IGL02313:Slc24a5 APN 2 125085647 unclassified probably benign
IGL02328:Slc24a5 APN 2 125080639 missense probably damaging 1.00
IGL02743:Slc24a5 APN 2 125088234 missense probably damaging 1.00
IGL02969:Slc24a5 APN 2 125083227 missense probably damaging 1.00
IGL03212:Slc24a5 APN 2 125080830 missense probably damaging 1.00
IGL03258:Slc24a5 APN 2 125080705 critical splice donor site probably null
R0344:Slc24a5 UTSW 2 125085701 missense probably benign 0.03
R0811:Slc24a5 UTSW 2 125068804 missense probably damaging 0.98
R0812:Slc24a5 UTSW 2 125068804 missense probably damaging 0.98
R1018:Slc24a5 UTSW 2 125068907 missense probably damaging 1.00
R1574:Slc24a5 UTSW 2 125080862 missense probably damaging 0.96
R1574:Slc24a5 UTSW 2 125080862 missense probably damaging 0.96
R1753:Slc24a5 UTSW 2 125083195 missense possibly damaging 0.53
R2147:Slc24a5 UTSW 2 125087441 missense probably damaging 1.00
R4934:Slc24a5 UTSW 2 125088020 missense probably damaging 1.00
R4964:Slc24a5 UTSW 2 125068268 missense probably benign 0.20
R4966:Slc24a5 UTSW 2 125068268 missense probably benign 0.20
R5225:Slc24a5 UTSW 2 125085819 missense probably damaging 0.99
R5275:Slc24a5 UTSW 2 125085861 missense probably benign 0.09
R5438:Slc24a5 UTSW 2 125068865 missense probably damaging 1.00
R6038:Slc24a5 UTSW 2 125085731 missense probably benign 0.04
R6038:Slc24a5 UTSW 2 125085731 missense probably benign 0.04
R6114:Slc24a5 UTSW 2 125083092 missense probably benign 0.01
R6211:Slc24a5 UTSW 2 125088251 missense probably benign 0.23
R6516:Slc24a5 UTSW 2 125088107 missense probably benign 0.01
R6675:Slc24a5 UTSW 2 125080695 missense possibly damaging 0.82
R6677:Slc24a5 UTSW 2 125080695 missense possibly damaging 0.82
R6826:Slc24a5 UTSW 2 125068858 missense probably benign 0.00
R7100:Slc24a5 UTSW 2 125080671 missense not run
R7122:Slc24a5 UTSW 2 125088191 missense not run
X0067:Slc24a5 UTSW 2 125087503 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CATTTCTTCTGACCAGCAGTAATAG -3'
(R):5'- ACTGTGACCATCCAAACTAGG -3'

Sequencing Primer
(F):5'- ATGCTGAGACCGTTTGACAC -3'
(R):5'- CCAAACTAGGATGTATGTGAATGC -3'
Posted On2017-02-10