Incidental Mutation 'R5866:Zfp97'
ID454197
Institutional Source Beutler Lab
Gene Symbol Zfp97
Ensembl Gene ENSMUSG00000095990
Gene Namezinc finger protein 97
Synonyms
MMRRC Submission 044075-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R5866 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location17121415-17146831 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17144825 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 195 (F195L)
Ref Sequence ENSEMBL: ENSMUSP00000114301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147630]
Predicted Effect possibly damaging
Transcript: ENSMUST00000147630
AA Change: F195L

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114301
Gene: ENSMUSG00000095990
AA Change: F195L

DomainStartEndE-ValueType
KRAB 13 82 4.42e-16 SMART
ZnF_C2H2 158 180 6.88e-4 SMART
ZnF_C2H2 186 208 4.4e-2 SMART
ZnF_C2H2 236 260 4.57e0 SMART
ZnF_C2H2 266 288 6.32e-3 SMART
ZnF_C2H2 294 316 8.94e-3 SMART
ZnF_C2H2 322 344 2.53e-2 SMART
ZnF_C2H2 350 372 9.73e-4 SMART
ZnF_C2H2 378 400 3.89e-3 SMART
ZnF_C2H2 406 428 8.94e-3 SMART
ZnF_C2H2 434 456 1.18e-2 SMART
ZnF_C2H2 462 484 7.9e-4 SMART
ZnF_C2H2 490 512 7.78e-3 SMART
ZnF_C2H2 518 540 3.95e-4 SMART
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.2%
  • 20x: 90.7%
Validation Efficiency 91% (51/56)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik A G 1: 120,169,084 probably benign Het
A530084C06Rik G A 13: 31,559,195 A25V unknown Het
A730018C14Rik T C 12: 112,415,038 noncoding transcript Het
Aasdh G T 5: 76,876,211 A198E probably damaging Het
Abcb8 C T 5: 24,402,103 A328V probably damaging Het
Ace3 C A 11: 105,997,504 H347N probably damaging Het
Amy1 A T 3: 113,561,920 M302K possibly damaging Het
Apol11b C T 15: 77,640,547 V13M probably null Het
Arfgef2 T A 2: 166,836,257 V131E possibly damaging Het
Arnt T A 3: 95,490,726 probably benign Het
Atl1 T C 12: 69,926,011 V35A probably damaging Het
BC061237 A T 14: 44,501,273 D43V possibly damaging Het
C530008M17Rik A G 5: 76,857,537 T582A unknown Het
Cyp4f17 T C 17: 32,506,913 S7P probably benign Het
Ddx60 A G 8: 61,940,740 Y70C probably damaging Het
Defb34 T C 8: 19,126,452 L53P probably damaging Het
Dennd5a T C 7: 109,919,360 T525A probably benign Het
Ephb3 T C 16: 21,211,379 probably benign Het
Fam83d T A 2: 158,779,830 probably null Het
Gramd3 A G 18: 56,474,036 D74G possibly damaging Het
Hax1 A G 3: 89,995,728 probably benign Het
Kcnh8 T C 17: 52,956,776 I767T probably benign Het
Ldah G A 12: 8,220,614 V5I possibly damaging Het
Nbeal2 A G 9: 110,631,492 V1758A probably damaging Het
Nos1 A G 5: 117,895,902 D363G probably damaging Het
Olfr127 C T 17: 37,903,809 R88* probably null Het
Pdlim7 T A 13: 55,498,688 D445V probably damaging Het
Phip T A 9: 82,890,150 M1115L probably benign Het
Pigb C T 9: 73,029,684 A215T probably damaging Het
Pkd1 A T 17: 24,580,961 S2952C probably damaging Het
Plxnb2 T C 15: 89,167,572 D148G probably damaging Het
Ppp1r36 T C 12: 76,426,805 F70S possibly damaging Het
Rad52 G A 6: 119,912,946 probably benign Het
Rasa2 T A 9: 96,545,770 T681S probably benign Het
Rel A T 11: 23,742,724 Y436* probably null Het
Sec16a G A 2: 26,419,638 P2119S probably benign Het
Sema6d C A 2: 124,664,342 T733K probably benign Het
Sf3b3 C T 8: 110,814,634 A950T probably benign Het
Slc24a5 T A 2: 125,085,671 F297I probably damaging Het
Spp2 A T 1: 88,412,303 D122V possibly damaging Het
Stap1 A G 5: 86,078,047 K60R probably benign Het
Stat1 A G 1: 52,139,264 K286E probably damaging Het
Stn1 T C 19: 47,517,129 T129A probably benign Het
Tagap C T 17: 7,933,453 T490I probably damaging Het
Tbc1d2 T C 4: 46,637,715 E177G possibly damaging Het
Tln2 A T 9: 67,266,868 L841Q probably damaging Het
Tmem59 T A 4: 107,190,557 M71K probably damaging Het
Ugt2a3 G A 5: 87,336,547 T206I probably damaging Het
Utp20 G A 10: 88,772,559 H1539Y possibly damaging Het
Vps13a T C 19: 16,680,023 N1794S probably benign Het
Vsig10 A T 5: 117,352,749 probably null Het
Other mutations in Zfp97
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0812:Zfp97 UTSW 17 17145290 missense possibly damaging 0.77
R1550:Zfp97 UTSW 17 17145206 nonsense probably null
R1920:Zfp97 UTSW 17 17145003 missense probably benign 0.00
R2058:Zfp97 UTSW 17 17144756 missense possibly damaging 0.57
R4896:Zfp97 UTSW 17 17144776 missense probably benign 0.09
R4967:Zfp97 UTSW 17 17145131 missense probably damaging 1.00
R4967:Zfp97 UTSW 17 17144676 nonsense probably null
R5341:Zfp97 UTSW 17 17145210 missense probably damaging 1.00
R5714:Zfp97 UTSW 17 17145609 missense possibly damaging 0.86
R6861:Zfp97 UTSW 17 17145175 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACACTGGATCTTTCATGTC -3'
(R):5'- GAAGAGTTTTGTGATATGCAAAGGC -3'

Sequencing Primer
(F):5'- AGTCTATGATGGTAACCAATGTGG -3'
(R):5'- GCAAAGGCTTTCCAACATTGG -3'
Posted On2017-02-10