Incidental Mutation 'R5867:Mefv'
ID454245
Institutional Source Beutler Lab
Gene Symbol Mefv
Ensembl Gene ENSMUSG00000022534
Gene NameMediterranean fever
SynonymsTRIM20, marenostrin, pyrin, FMF
MMRRC Submission 043233-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5867 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location3707218-3718097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3715933 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 158 (D158G)
Ref Sequence ENSEMBL: ENSMUSP00000154892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023180] [ENSMUST00000100222] [ENSMUST00000229725]
Predicted Effect probably damaging
Transcript: ENSMUST00000023180
AA Change: D158G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023180
Gene: ENSMUSG00000022534
AA Change: D158G

DomainStartEndE-ValueType
PYRIN 5 88 8.89e-32 SMART
BBOX 439 481 4.75e-11 SMART
low complexity region 490 503 N/A INTRINSIC
SCOP:d1f5qb1 519 616 8e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100222
AA Change: D158G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097795
Gene: ENSMUSG00000022534
AA Change: D158G

DomainStartEndE-ValueType
PYRIN 5 88 8.89e-32 SMART
BBOX 469 511 4.75e-11 SMART
low complexity region 520 533 N/A INTRINSIC
SCOP:d1f5qb1 549 646 6e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229725
AA Change: D158G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein, also known as pyrin or marenostrin, that is an important modulator of innate immunity. Mutations in this gene are associated with Mediterranean fever, a hereditary periodic fever syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop normally but show increased susceptibilty to infection. Mice homozygous for another knock-out allele exhibit increased macrophage secretion of IL1b and Il18 following stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,052 V2900A probably damaging Het
Akip1 A G 7: 109,707,477 H127R probably benign Het
Alad A T 4: 62,512,966 Y56N probably damaging Het
Aldoart1 T A 4: 72,852,533 M13L probably benign Het
Ap1g1 C T 8: 109,818,982 A89V probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Cd209b T C 8: 3,924,246 I89V possibly damaging Het
Cd36 T C 5: 17,785,735 K469R probably benign Het
Cdh7 T A 1: 110,048,851 I82N probably damaging Het
Clmn G T 12: 104,781,755 P511H probably damaging Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Cyp2a5 T C 7: 26,842,958 F462L probably benign Het
Dclk2 A G 3: 86,791,859 *709Q probably null Het
Drd1 T C 13: 54,054,163 T4A probably benign Het
Ephb2 C T 4: 136,675,422 V513I possibly damaging Het
Fam43a T A 16: 30,601,459 V287E probably benign Het
Gm5134 A G 10: 76,008,616 E602G probably benign Het
Gtsf2 C T 15: 103,439,636 G149E probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klhl6 T C 16: 19,982,820 T62A probably benign Het
Lamb1 T A 12: 31,298,955 I662N possibly damaging Het
Lmod3 A G 6: 97,248,002 V286A probably damaging Het
Mff T C 1: 82,750,606 probably null Het
Mfsd6l G T 11: 68,557,210 V296L possibly damaging Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Olfr1033 A G 2: 86,041,451 I45M probably benign Het
Pdk4 T A 6: 5,487,452 H266L probably benign Het
Pdrg1 T C 2: 153,014,055 N40D probably damaging Het
Pi4k2a T C 19: 42,105,485 probably null Het
Pkd1l2 T A 8: 117,055,011 D765V probably damaging Het
Pspc1 A T 14: 56,762,041 probably null Het
Ptprm T C 17: 67,045,981 probably null Het
Spata31d1d T C 13: 59,727,240 K827R possibly damaging Het
Srebf2 T A 15: 82,169,786 F46Y probably damaging Het
Tfrc T A 16: 32,620,412 C365S possibly damaging Het
Ttc7 A G 17: 87,322,472 H294R possibly damaging Het
Ubr7 T A 12: 102,761,494 Y92N probably damaging Het
Vmn1r42 A C 6: 89,844,779 Y269* probably null Het
Vmn2r1 A G 3: 64,104,569 E617G probably benign Het
Vps13c A G 9: 67,982,622 probably null Het
Vps50 T C 6: 3,536,965 L312P probably damaging Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zcchc3 A G 2: 152,414,524 F85S probably damaging Het
Zfhx3 T C 8: 108,793,446 L400P probably damaging Het
Other mutations in Mefv
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Mefv APN 16 3710960 missense probably benign 0.01
IGL00583:Mefv APN 16 3716072 nonsense probably null
IGL00963:Mefv APN 16 3715720 missense possibly damaging 0.83
IGL02185:Mefv APN 16 3715850 missense probably benign 0.09
IGL02500:Mefv APN 16 3713577 missense probably damaging 1.00
R0158:Mefv UTSW 16 3715456 missense possibly damaging 0.67
R1312:Mefv UTSW 16 3708534 splice site probably benign
R1793:Mefv UTSW 16 3708664 missense possibly damaging 0.53
R1956:Mefv UTSW 16 3717827 missense probably damaging 1.00
R2169:Mefv UTSW 16 3710888 missense probably benign 0.24
R2973:Mefv UTSW 16 3715694 nonsense probably null
R3723:Mefv UTSW 16 3708194 critical splice donor site probably null
R3724:Mefv UTSW 16 3708194 critical splice donor site probably null
R3953:Mefv UTSW 16 3715400 missense possibly damaging 0.60
R4276:Mefv UTSW 16 3715569 missense probably benign 0.41
R4650:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4651:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4652:Mefv UTSW 16 3717818 missense probably damaging 1.00
R4670:Mefv UTSW 16 3708207 missense possibly damaging 0.67
R4781:Mefv UTSW 16 3715334 missense probably benign 0.00
R5593:Mefv UTSW 16 3715451 missense probably benign 0.00
R5834:Mefv UTSW 16 3716046 missense probably damaging 0.97
R5954:Mefv UTSW 16 3715715 missense probably benign 0.09
R6056:Mefv UTSW 16 3708042 missense possibly damaging 0.73
R6260:Mefv UTSW 16 3713034 missense probably benign 0.03
R6409:Mefv UTSW 16 3710793 critical splice donor site probably null
R6511:Mefv UTSW 16 3715946 missense probably benign 0.00
R6666:Mefv UTSW 16 3707998 missense possibly damaging 0.88
R6952:Mefv UTSW 16 3710880 missense probably damaging 1.00
R7259:Mefv UTSW 16 3713053 missense probably damaging 1.00
R7410:Mefv UTSW 16 3715681 missense probably damaging 1.00
R7444:Mefv UTSW 16 3715522 missense probably benign 0.21
X0064:Mefv UTSW 16 3710841 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GTAAAGTCCTTGAAGCCTCCC -3'
(R):5'- GCACAGCTTCATGACTGTATC -3'

Sequencing Primer
(F):5'- CTGCAGAGCTGACATTCCTG -3'
(R):5'- AAGAAAATAGAGTTGGTGGTTCTGTC -3'
Posted On2017-02-10