Incidental Mutation 'R5881:Olfr1271'
ID454402
Institutional Source Beutler Lab
Gene Symbol Olfr1271
Ensembl Gene ENSMUSG00000075062
Gene Nameolfactory receptor 1271
SynonymsGA_x6K02T2Q125-51620802-51619885, MOR227-5
MMRRC Submission 044085-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5881 (G1)
Quality Score152
Status Not validated
Chromosome2
Chromosomal Location90260546-90271032 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 90266442 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099751] [ENSMUST00000216383]
Predicted Effect probably null
Transcript: ENSMUST00000099751
SMART Domains Protein: ENSMUSP00000097340
Gene: ENSMUSG00000075062

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.1e-50 PFAM
Pfam:7tm_1 39 285 6.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217396
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.3%
  • 10x: 94.5%
  • 20x: 78.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 A C 11: 95,834,387 L159W probably damaging Het
Abi3 A T 11: 95,834,388 L159M probably damaging Het
Adam11 A C 11: 102,773,810 I406L probably benign Het
Ager G T 17: 34,600,077 V300L probably damaging Het
Ank3 C T 10: 69,986,830 S1726L probably benign Het
Boc A G 16: 44,490,651 I740T probably damaging Het
C8a T A 4: 104,853,932 D178V probably damaging Het
Ces3a G A 8: 105,050,566 V174M probably damaging Het
Cisd1 A T 10: 71,336,414 W13R probably damaging Het
Commd8 A T 5: 72,162,764 D111E probably benign Het
Ddx60 A T 8: 62,037,070 D1691V probably damaging Het
Desi2 A G 1: 178,237,913 Y15C probably damaging Het
Dnmt1 A G 9: 20,952,717 V24A probably damaging Het
Dock10 G A 1: 80,560,923 T968M probably benign Het
Dsel A T 1: 111,859,438 F1122L probably damaging Het
Eml3 T C 19: 8,933,443 F220L probably damaging Het
Entpd2 A C 2: 25,400,812 N443H probably damaging Het
Epgn A G 5: 91,028,363 N36S probably benign Het
Fsip2 G T 2: 82,984,441 S3506I possibly damaging Het
Gm10436 A G 12: 88,176,341 L169P probably damaging Het
Gprin3 T C 6: 59,354,786 S179G probably benign Het
Grifin G T 5: 140,563,587 H125N possibly damaging Het
Hils1 A G 11: 94,968,163 T95A possibly damaging Het
Hmcn1 A G 1: 150,630,327 V3816A probably damaging Het
Hspa14 A G 2: 3,498,170 F196L probably benign Het
Ice1 T C 13: 70,606,501 K489E probably benign Het
Jmjd6 C T 11: 116,839,856 W117* probably null Het
Lrit2 G T 14: 37,072,235 A419S probably benign Het
Mc3r T C 2: 172,249,172 S105P probably benign Het
Mccc1 A G 3: 35,964,382 V601A probably benign Het
Myo1f A G 17: 33,576,653 D91G probably damaging Het
Myo1f G A 17: 33,580,285 E255K possibly damaging Het
Necap1 T A 6: 122,881,544 D115E probably benign Het
Olfr65 T A 7: 103,906,676 M79K probably damaging Het
Olfr725 G A 14: 50,034,987 R139C probably benign Het
Papd4 A T 13: 93,175,738 C180* probably null Het
Papln A G 12: 83,771,878 E78G probably null Het
Phldb3 T C 7: 24,626,722 probably null Het
Pkd1l2 A G 8: 116,997,582 I2394T probably damaging Het
Ppa2 A T 3: 133,330,439 N118I probably damaging Het
Ppef2 A T 5: 92,250,529 C43* probably null Het
Rab27a G A 9: 73,085,039 probably null Het
Rabgap1l A T 1: 160,342,113 F47I probably damaging Het
Rala A G 13: 17,893,161 I95T probably damaging Het
Rgl2 A G 17: 33,932,717 D245G probably benign Het
Rnf34 A T 5: 122,864,083 T35S probably damaging Het
Ros1 C T 10: 52,181,798 R51Q probably benign Het
Samd9l T C 6: 3,372,716 D1515G possibly damaging Het
Scn7a T C 2: 66,675,526 E1673G probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Tdrd5 A T 1: 156,294,500 S280T probably damaging Het
Tie1 T C 4: 118,475,603 I911V possibly damaging Het
Vipas39 G A 12: 87,251,807 R194* probably null Het
Ybx3 A C 6: 131,368,488 N307K possibly damaging Het
Ylpm1 A T 12: 85,042,125 H1216L probably damaging Het
Other mutations in Olfr1271
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Olfr1271 APN 2 90265951 missense probably damaging 0.97
IGL02901:Olfr1271 APN 2 90265708 missense probably damaging 1.00
PIT4466001:Olfr1271 UTSW 2 90266295 missense probably damaging 0.97
PIT4468001:Olfr1271 UTSW 2 90266220 missense probably benign 0.00
R0325:Olfr1271 UTSW 2 90265536 missense probably null
R1350:Olfr1271 UTSW 2 90266346 missense probably damaging 0.97
R1888:Olfr1271 UTSW 2 90265569 missense probably damaging 1.00
R1888:Olfr1271 UTSW 2 90265569 missense probably damaging 1.00
R2509:Olfr1271 UTSW 2 90265686 missense possibly damaging 0.91
R2510:Olfr1271 UTSW 2 90265606 missense probably damaging 0.98
R4113:Olfr1271 UTSW 2 90266340 missense probably damaging 1.00
R5414:Olfr1271 UTSW 2 90265702 missense probably benign 0.07
R5580:Olfr1271 UTSW 2 90266350 missense probably benign 0.00
R5664:Olfr1271 UTSW 2 90265615 missense probably damaging 0.96
R5666:Olfr1271 UTSW 2 90265964 missense probably benign 0.04
R5670:Olfr1271 UTSW 2 90265964 missense probably benign 0.04
R6493:Olfr1271 UTSW 2 90265708 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAGTCTTACTGATGCTGACTGTC -3'
(R):5'- AGATACCCGGGCTGAAAGTTAG -3'

Sequencing Primer
(F):5'- GACTGTCACAAAAATAAGACCGTTG -3'
(R):5'- GGCTGAAAGTTAGAAAGACTCATTC -3'
Posted On2017-02-10