Incidental Mutation 'R5881:Mc3r'
ID454403
Institutional Source Beutler Lab
Gene Symbol Mc3r
Ensembl Gene ENSMUSG00000038537
Gene Namemelanocortin 3 receptor
Synonyms
MMRRC Submission 044085-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R5881 (G1)
Quality Score173
Status Not validated
Chromosome2
Chromosomal Location172248492-172251114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172249172 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 105 (S105P)
Ref Sequence ENSEMBL: ENSMUSP00000047358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038532]
Predicted Effect probably benign
Transcript: ENSMUST00000038532
AA Change: S105P

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000047358
Gene: ENSMUSG00000038537
AA Change: S105P

DomainStartEndE-ValueType
Pfam:7tm_4 45 198 3.2e-12 PFAM
Pfam:7TM_GPCR_Srsx 49 314 1.9e-7 PFAM
Pfam:7tm_1 55 299 5.4e-35 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.3%
  • 10x: 94.5%
  • 20x: 78.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the melanocortin receptor family. Melanocortin receptors are transmembrane G-protein coupled receptors, which respond to small peptide hormones and exhibit diverse functions and tissue type localization. As part of the central nervous melanocortin system, the encoded protein is competitively bound by either melanocyte stimulating hormone or agouti-related protein to regulate energy homeostasis and adaptation to food restriction. Disruption of this gene results in an increased ratio of weight gain to food intake, increased fat mass, and decreased lean mass, without having a large effect on insulin sensitivity or glucose metabolism. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a null allele exhibit obesity, increased respiratory quotient on a high fat diet, and reduced energy expenditure. Homozygotes for another null allele show reduced lean mass, increased fat mass, diet-induced obesity, increased insulin and leptin levels, and reduced energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 A C 11: 95,834,387 L159W probably damaging Het
Abi3 A T 11: 95,834,388 L159M probably damaging Het
Adam11 A C 11: 102,773,810 I406L probably benign Het
Ager G T 17: 34,600,077 V300L probably damaging Het
Ank3 C T 10: 69,986,830 S1726L probably benign Het
Boc A G 16: 44,490,651 I740T probably damaging Het
C8a T A 4: 104,853,932 D178V probably damaging Het
Ces3a G A 8: 105,050,566 V174M probably damaging Het
Cisd1 A T 10: 71,336,414 W13R probably damaging Het
Commd8 A T 5: 72,162,764 D111E probably benign Het
Ddx60 A T 8: 62,037,070 D1691V probably damaging Het
Desi2 A G 1: 178,237,913 Y15C probably damaging Het
Dnmt1 A G 9: 20,952,717 V24A probably damaging Het
Dock10 G A 1: 80,560,923 T968M probably benign Het
Dsel A T 1: 111,859,438 F1122L probably damaging Het
Eml3 T C 19: 8,933,443 F220L probably damaging Het
Entpd2 A C 2: 25,400,812 N443H probably damaging Het
Epgn A G 5: 91,028,363 N36S probably benign Het
Fsip2 G T 2: 82,984,441 S3506I possibly damaging Het
Gm10436 A G 12: 88,176,341 L169P probably damaging Het
Gprin3 T C 6: 59,354,786 S179G probably benign Het
Grifin G T 5: 140,563,587 H125N possibly damaging Het
Hils1 A G 11: 94,968,163 T95A possibly damaging Het
Hmcn1 A G 1: 150,630,327 V3816A probably damaging Het
Hspa14 A G 2: 3,498,170 F196L probably benign Het
Ice1 T C 13: 70,606,501 K489E probably benign Het
Jmjd6 C T 11: 116,839,856 W117* probably null Het
Lrit2 G T 14: 37,072,235 A419S probably benign Het
Mccc1 A G 3: 35,964,382 V601A probably benign Het
Myo1f A G 17: 33,576,653 D91G probably damaging Het
Myo1f G A 17: 33,580,285 E255K possibly damaging Het
Necap1 T A 6: 122,881,544 D115E probably benign Het
Olfr1271 A T 2: 90,266,442 probably null Het
Olfr65 T A 7: 103,906,676 M79K probably damaging Het
Olfr725 G A 14: 50,034,987 R139C probably benign Het
Papd4 A T 13: 93,175,738 C180* probably null Het
Papln A G 12: 83,771,878 E78G probably null Het
Phldb3 T C 7: 24,626,722 probably null Het
Pkd1l2 A G 8: 116,997,582 I2394T probably damaging Het
Ppa2 A T 3: 133,330,439 N118I probably damaging Het
Ppef2 A T 5: 92,250,529 C43* probably null Het
Rab27a G A 9: 73,085,039 probably null Het
Rabgap1l A T 1: 160,342,113 F47I probably damaging Het
Rala A G 13: 17,893,161 I95T probably damaging Het
Rgl2 A G 17: 33,932,717 D245G probably benign Het
Rnf34 A T 5: 122,864,083 T35S probably damaging Het
Ros1 C T 10: 52,181,798 R51Q probably benign Het
Samd9l T C 6: 3,372,716 D1515G possibly damaging Het
Scn7a T C 2: 66,675,526 E1673G probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Tdrd5 A T 1: 156,294,500 S280T probably damaging Het
Tie1 T C 4: 118,475,603 I911V possibly damaging Het
Vipas39 G A 12: 87,251,807 R194* probably null Het
Ybx3 A C 6: 131,368,488 N307K possibly damaging Het
Ylpm1 A T 12: 85,042,125 H1216L probably damaging Het
Other mutations in Mc3r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Mc3r APN 2 172249028 missense possibly damaging 0.95
IGL01618:Mc3r APN 2 172249370 missense probably benign
IGL01784:Mc3r APN 2 172249370 missense probably benign
IGL01865:Mc3r APN 2 172249055 missense probably damaging 1.00
IGL02164:Mc3r APN 2 172249394 missense probably damaging 1.00
IGL03011:Mc3r APN 2 172249796 missense probably benign 0.08
IGL03266:Mc3r APN 2 172249269 missense probably benign 0.01
R0882:Mc3r UTSW 2 172249791 missense probably benign 0.00
R1005:Mc3r UTSW 2 172249563 missense probably benign 0.00
R1501:Mc3r UTSW 2 172249380 missense probably benign 0.19
R2374:Mc3r UTSW 2 172249154 missense possibly damaging 0.84
R3437:Mc3r UTSW 2 172249668 missense probably benign 0.23
R3813:Mc3r UTSW 2 172248879 missense probably benign 0.06
R3936:Mc3r UTSW 2 172249296 missense probably damaging 1.00
R4225:Mc3r UTSW 2 172249034 missense probably damaging 1.00
R4491:Mc3r UTSW 2 172249203 missense possibly damaging 0.50
R5074:Mc3r UTSW 2 172249613 missense possibly damaging 0.95
R5277:Mc3r UTSW 2 172249787 missense probably damaging 1.00
R5706:Mc3r UTSW 2 172249690 nonsense probably null
R5832:Mc3r UTSW 2 172249430 missense probably benign 0.01
R5865:Mc3r UTSW 2 172249672 missense possibly damaging 0.84
R5905:Mc3r UTSW 2 172249209 missense probably damaging 1.00
R6028:Mc3r UTSW 2 172249209 missense probably damaging 1.00
R6492:Mc3r UTSW 2 172249154 missense possibly damaging 0.84
R7037:Mc3r UTSW 2 172249634 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGAGCAGGTCTTCATCAAG -3'
(R):5'- ATGACCCCGATCAAGGTGAG -3'

Sequencing Primer
(F):5'- AGGTCTTCATCAAGCCGGAG -3'
(R):5'- CCGATCAAGGTGAGGGCTTTC -3'
Posted On2017-02-10