Incidental Mutation 'R5881:Vipas39'
ID454439
Institutional Source Beutler Lab
Gene Symbol Vipas39
Ensembl Gene ENSMUSG00000021038
Gene NameVPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
Synonyms
MMRRC Submission 044085-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R5881 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location87238868-87266256 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 87251807 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 194 (R194*)
Ref Sequence ENSEMBL: ENSMUSP00000137190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021426] [ENSMUST00000072744] [ENSMUST00000179379]
Predicted Effect probably null
Transcript: ENSMUST00000021426
AA Change: R194*
SMART Domains Protein: ENSMUSP00000021426
Gene: ENSMUSG00000021038
AA Change: R194*

DomainStartEndE-ValueType
Pfam:Golgin_A5 24 470 4.3e-147 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000072744
AA Change: R213*
SMART Domains Protein: ENSMUSP00000072527
Gene: ENSMUSG00000021038
AA Change: R213*

DomainStartEndE-ValueType
Pfam:Golgin_A5 24 489 3.7e-154 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179379
AA Change: R194*
SMART Domains Protein: ENSMUSP00000137190
Gene: ENSMUSG00000021038
AA Change: R194*

DomainStartEndE-ValueType
Pfam:Golgin_A5 24 470 4.3e-147 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221707
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222350
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.3%
  • 10x: 94.5%
  • 20x: 78.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in the sorting of lysosomal proteins. Mutations in this gene are associated with ARCS2 (arthrogryposis, renal dysfunction, and cholestasis-2). Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a conditional allele activated by an inducible cre exhibit dry and scaly skin, hair loss, and defects in tail tendon collagen I structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 A C 11: 95,834,387 L159W probably damaging Het
Abi3 A T 11: 95,834,388 L159M probably damaging Het
Adam11 A C 11: 102,773,810 I406L probably benign Het
Ager G T 17: 34,600,077 V300L probably damaging Het
Ank3 C T 10: 69,986,830 S1726L probably benign Het
Boc A G 16: 44,490,651 I740T probably damaging Het
C8a T A 4: 104,853,932 D178V probably damaging Het
Ces3a G A 8: 105,050,566 V174M probably damaging Het
Cisd1 A T 10: 71,336,414 W13R probably damaging Het
Commd8 A T 5: 72,162,764 D111E probably benign Het
Ddx60 A T 8: 62,037,070 D1691V probably damaging Het
Desi2 A G 1: 178,237,913 Y15C probably damaging Het
Dnmt1 A G 9: 20,952,717 V24A probably damaging Het
Dock10 G A 1: 80,560,923 T968M probably benign Het
Dsel A T 1: 111,859,438 F1122L probably damaging Het
Eml3 T C 19: 8,933,443 F220L probably damaging Het
Entpd2 A C 2: 25,400,812 N443H probably damaging Het
Epgn A G 5: 91,028,363 N36S probably benign Het
Fsip2 G T 2: 82,984,441 S3506I possibly damaging Het
Gm10436 A G 12: 88,176,341 L169P probably damaging Het
Gprin3 T C 6: 59,354,786 S179G probably benign Het
Grifin G T 5: 140,563,587 H125N possibly damaging Het
Hils1 A G 11: 94,968,163 T95A possibly damaging Het
Hmcn1 A G 1: 150,630,327 V3816A probably damaging Het
Hspa14 A G 2: 3,498,170 F196L probably benign Het
Ice1 T C 13: 70,606,501 K489E probably benign Het
Jmjd6 C T 11: 116,839,856 W117* probably null Het
Lrit2 G T 14: 37,072,235 A419S probably benign Het
Mc3r T C 2: 172,249,172 S105P probably benign Het
Mccc1 A G 3: 35,964,382 V601A probably benign Het
Myo1f A G 17: 33,576,653 D91G probably damaging Het
Myo1f G A 17: 33,580,285 E255K possibly damaging Het
Necap1 T A 6: 122,881,544 D115E probably benign Het
Olfr1271 A T 2: 90,266,442 probably null Het
Olfr65 T A 7: 103,906,676 M79K probably damaging Het
Olfr725 G A 14: 50,034,987 R139C probably benign Het
Papd4 A T 13: 93,175,738 C180* probably null Het
Papln A G 12: 83,771,878 E78G probably null Het
Phldb3 T C 7: 24,626,722 probably null Het
Pkd1l2 A G 8: 116,997,582 I2394T probably damaging Het
Ppa2 A T 3: 133,330,439 N118I probably damaging Het
Ppef2 A T 5: 92,250,529 C43* probably null Het
Rab27a G A 9: 73,085,039 probably null Het
Rabgap1l A T 1: 160,342,113 F47I probably damaging Het
Rala A G 13: 17,893,161 I95T probably damaging Het
Rgl2 A G 17: 33,932,717 D245G probably benign Het
Rnf34 A T 5: 122,864,083 T35S probably damaging Het
Ros1 C T 10: 52,181,798 R51Q probably benign Het
Samd9l T C 6: 3,372,716 D1515G possibly damaging Het
Scn7a T C 2: 66,675,526 E1673G probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Tdrd5 A T 1: 156,294,500 S280T probably damaging Het
Tie1 T C 4: 118,475,603 I911V possibly damaging Het
Ybx3 A C 6: 131,368,488 N307K possibly damaging Het
Ylpm1 A T 12: 85,042,125 H1216L probably damaging Het
Other mutations in Vipas39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Vipas39 APN 12 87249397 missense probably benign 0.03
IGL01418:Vipas39 APN 12 87249397 missense probably benign 0.03
IGL02026:Vipas39 APN 12 87251709 splice site probably benign
IGL03089:Vipas39 APN 12 87253254 missense probably damaging 1.00
R0173:Vipas39 UTSW 12 87250511 splice site probably benign
R0909:Vipas39 UTSW 12 87241331 missense probably benign 0.21
R1505:Vipas39 UTSW 12 87246160 missense probably damaging 1.00
R2897:Vipas39 UTSW 12 87242523 missense possibly damaging 0.78
R2968:Vipas39 UTSW 12 87242571 missense probably benign 0.45
R2969:Vipas39 UTSW 12 87242571 missense probably benign 0.45
R2970:Vipas39 UTSW 12 87242571 missense probably benign 0.45
R4622:Vipas39 UTSW 12 87244543 missense probably damaging 1.00
R4676:Vipas39 UTSW 12 87241301 missense probably damaging 1.00
R5181:Vipas39 UTSW 12 87239827 missense probably damaging 1.00
R5188:Vipas39 UTSW 12 87254247 missense probably benign 0.21
R6080:Vipas39 UTSW 12 87241953 missense probably damaging 1.00
R6425:Vipas39 UTSW 12 87241289 missense probably damaging 0.98
R6896:Vipas39 UTSW 12 87242571 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CAGCACATTTCAAGATCTTGCTTTC -3'
(R):5'- TAGTGCAGAGAGGCTGTTAATGATG -3'

Sequencing Primer
(F):5'- TCTGGAAAAGGACAGTGTCTTC -3'
(R):5'- TAATGATGGTGGGTGGAGACC -3'
Posted On2017-02-10