Incidental Mutation 'R5881:Papd4'
ID454443
Institutional Source Beutler Lab
Gene Symbol Papd4
Ensembl Gene ENSMUSG00000042167
Gene NamePAP associated domain containing 4
Synonyms8030446C20Rik
MMRRC Submission 044085-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R5881 (G1)
Quality Score202
Status Not validated
Chromosome13
Chromosomal Location93146282-93192385 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 93175738 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 180 (C180*)
Ref Sequence ENSEMBL: ENSMUSP00000153703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048702] [ENSMUST00000224545] [ENSMUST00000225868]
Predicted Effect probably null
Transcript: ENSMUST00000048702
AA Change: C180*
SMART Domains Protein: ENSMUSP00000048124
Gene: ENSMUSG00000042167
AA Change: C180*

DomainStartEndE-ValueType
low complexity region 134 147 N/A INTRINSIC
Pfam:PAP_assoc 386 440 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224545
Predicted Effect probably null
Transcript: ENSMUST00000225868
AA Change: C180*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.3%
  • 10x: 94.5%
  • 20x: 78.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele reuslts in disruption in polyadenylation in oocytes and somatic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3 A C 11: 95,834,387 L159W probably damaging Het
Abi3 A T 11: 95,834,388 L159M probably damaging Het
Adam11 A C 11: 102,773,810 I406L probably benign Het
Ager G T 17: 34,600,077 V300L probably damaging Het
Ank3 C T 10: 69,986,830 S1726L probably benign Het
Boc A G 16: 44,490,651 I740T probably damaging Het
C8a T A 4: 104,853,932 D178V probably damaging Het
Ces3a G A 8: 105,050,566 V174M probably damaging Het
Cisd1 A T 10: 71,336,414 W13R probably damaging Het
Commd8 A T 5: 72,162,764 D111E probably benign Het
Ddx60 A T 8: 62,037,070 D1691V probably damaging Het
Desi2 A G 1: 178,237,913 Y15C probably damaging Het
Dnmt1 A G 9: 20,952,717 V24A probably damaging Het
Dock10 G A 1: 80,560,923 T968M probably benign Het
Dsel A T 1: 111,859,438 F1122L probably damaging Het
Eml3 T C 19: 8,933,443 F220L probably damaging Het
Entpd2 A C 2: 25,400,812 N443H probably damaging Het
Epgn A G 5: 91,028,363 N36S probably benign Het
Fsip2 G T 2: 82,984,441 S3506I possibly damaging Het
Gm10436 A G 12: 88,176,341 L169P probably damaging Het
Gprin3 T C 6: 59,354,786 S179G probably benign Het
Grifin G T 5: 140,563,587 H125N possibly damaging Het
Hils1 A G 11: 94,968,163 T95A possibly damaging Het
Hmcn1 A G 1: 150,630,327 V3816A probably damaging Het
Hspa14 A G 2: 3,498,170 F196L probably benign Het
Ice1 T C 13: 70,606,501 K489E probably benign Het
Jmjd6 C T 11: 116,839,856 W117* probably null Het
Lrit2 G T 14: 37,072,235 A419S probably benign Het
Mc3r T C 2: 172,249,172 S105P probably benign Het
Mccc1 A G 3: 35,964,382 V601A probably benign Het
Myo1f A G 17: 33,576,653 D91G probably damaging Het
Myo1f G A 17: 33,580,285 E255K possibly damaging Het
Necap1 T A 6: 122,881,544 D115E probably benign Het
Olfr1271 A T 2: 90,266,442 probably null Het
Olfr65 T A 7: 103,906,676 M79K probably damaging Het
Olfr725 G A 14: 50,034,987 R139C probably benign Het
Papln A G 12: 83,771,878 E78G probably null Het
Phldb3 T C 7: 24,626,722 probably null Het
Pkd1l2 A G 8: 116,997,582 I2394T probably damaging Het
Ppa2 A T 3: 133,330,439 N118I probably damaging Het
Ppef2 A T 5: 92,250,529 C43* probably null Het
Rab27a G A 9: 73,085,039 probably null Het
Rabgap1l A T 1: 160,342,113 F47I probably damaging Het
Rala A G 13: 17,893,161 I95T probably damaging Het
Rgl2 A G 17: 33,932,717 D245G probably benign Het
Rnf34 A T 5: 122,864,083 T35S probably damaging Het
Ros1 C T 10: 52,181,798 R51Q probably benign Het
Samd9l T C 6: 3,372,716 D1515G possibly damaging Het
Scn7a T C 2: 66,675,526 E1673G probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Tdrd5 A T 1: 156,294,500 S280T probably damaging Het
Tie1 T C 4: 118,475,603 I911V possibly damaging Het
Vipas39 G A 12: 87,251,807 R194* probably null Het
Ybx3 A C 6: 131,368,488 N307K possibly damaging Het
Ylpm1 A T 12: 85,042,125 H1216L probably damaging Het
Other mutations in Papd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Papd4 APN 13 93186397 missense probably benign 0.01
IGL02312:Papd4 APN 13 93175533 missense probably benign
IGL02896:Papd4 APN 13 93168437 missense probably damaging 1.00
IGL02802:Papd4 UTSW 13 93148941 missense probably damaging 1.00
R0538:Papd4 UTSW 13 93175615 splice site probably benign
R0568:Papd4 UTSW 13 93154992 missense probably benign 0.20
R0733:Papd4 UTSW 13 93155039 missense probably benign 0.05
R1136:Papd4 UTSW 13 93175697 critical splice donor site probably null
R1537:Papd4 UTSW 13 93175568 missense probably damaging 1.00
R1603:Papd4 UTSW 13 93175565 missense probably benign
R2508:Papd4 UTSW 13 93184218 missense probably damaging 1.00
R4920:Papd4 UTSW 13 93186325 nonsense probably null
R5916:Papd4 UTSW 13 93175547 missense probably damaging 1.00
R6333:Papd4 UTSW 13 93186313 nonsense probably null
R6783:Papd4 UTSW 13 93155018 missense probably benign 0.00
R6783:Papd4 UTSW 13 93155019 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATCGCCATCACTGCTTCGG -3'
(R):5'- CCAGGCCATTCTTTGTACTTGAATAAC -3'

Sequencing Primer
(F):5'- GGCACCAAATCCATTCAAAGATG -3'
(R):5'- TCAAGTTGAGTCAGCAGA -3'
Posted On2017-02-10