Incidental Mutation 'R5882:Tdrd1'
ID454493
Institutional Source Beutler Lab
Gene Symbol Tdrd1
Ensembl Gene ENSMUSG00000025081
Gene Nametudor domain containing 1
SynonymsMTR-1
MMRRC Submission 043236-MU
Accession Numbers

Genbank: NM_001002238

Is this an essential gene? Possibly essential (E-score: 0.610) question?
Stock #R5882 (G1)
Quality Score188
Status Not validated
Chromosome19
Chromosomal Location56826209-56870012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56848939 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 532 (R532C)
Ref Sequence ENSEMBL: ENSMUSP00000112786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078723] [ENSMUST00000111604] [ENSMUST00000111606] [ENSMUST00000121249]
Predicted Effect probably damaging
Transcript: ENSMUST00000078723
AA Change: R532C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077785
Gene: ENSMUSG00000025081
AA Change: R532C

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111604
AA Change: R532C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107231
Gene: ENSMUSG00000025081
AA Change: R532C

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111606
AA Change: R532C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107233
Gene: ENSMUSG00000025081
AA Change: R532C

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 3.5e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121249
AA Change: R532C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112786
Gene: ENSMUSG00000025081
AA Change: R532C

DomainStartEndE-ValueType
low complexity region 75 86 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Pfam:zf-MYND 163 199 9.9e-13 PFAM
TUDOR 306 365 6.45e-11 SMART
TUDOR 537 593 4.88e-11 SMART
low complexity region 698 714 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
TUDOR 755 813 3.97e-11 SMART
TUDOR 981 1038 1.27e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 96.5%
  • 20x: 86.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a tudor domain protein. Alternatively spliced transcript variants have been described but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male homozygous mice are sterile, displaying postnatal spermatogenic defects. Females are fertile. [provided by MGI curators]
Allele List at MGI

 All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol7e T A 15: 77,718,247 H348Q probably benign Het
Cacna1g T A 11: 94,459,819 E400V probably damaging Het
Cyp2j6 T A 4: 96,535,602 K176N probably benign Het
Dcaf4 T C 12: 83,539,429 V377A probably damaging Het
Dennd1a A G 2: 37,961,663 L71P probably damaging Het
Dmbx1 G T 4: 115,920,301 R117S probably damaging Het
Ep400 A G 5: 110,755,587 V382A probably benign Het
Kars G A 8: 112,003,425 R107* probably null Het
Kif16b C T 2: 142,707,258 probably null Het
Lrrc69 A G 4: 14,708,690 F218S probably damaging Het
Myo15b A G 11: 115,869,596 Y1158C probably damaging Het
Myom1 G C 17: 71,110,722 A1307P probably damaging Het
Nacad C T 11: 6,598,568 V1389I possibly damaging Het
Nit2 T C 16: 57,159,466 D132G probably benign Het
Nln G T 13: 104,059,498 D60E probably benign Het
Oas1f G A 5: 120,848,253 E90K probably damaging Het
Obox3 A G 7: 15,626,968 V82A probably benign Het
Olfr1277 A T 2: 111,270,139 V76E probably damaging Het
Olfr874 C T 9: 37,746,632 T166I probably benign Het
Pcdhb1 A T 18: 37,267,177 Q727L probably benign Het
Phactr1 G T 13: 42,709,851 probably null Het
Prkg1 A T 19: 31,585,697 N116K probably damaging Het
Scnn1g A T 7: 121,767,358 S593C possibly damaging Het
Serpina6 T C 12: 103,654,235 N85S probably benign Het
Spock3 A G 8: 63,143,931 T93A probably benign Het
St7 T C 6: 17,846,249 L121P probably damaging Het
Stoml2 G C 4: 43,031,003 R57G probably damaging Het
Tmc5 A G 7: 118,654,919 N660S probably damaging Het
Tmem38a A G 8: 72,585,887 H233R probably damaging Het
Trp53bp2 T C 1: 182,442,212 V304A possibly damaging Het
Ush1g C A 11: 115,318,542 M275I probably damaging Het
Zfp882 A T 8: 71,913,459 probably null Het
Zim1 A T 7: 6,682,738 probably null Het
Other mutations in Tdrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Tdrd1 APN 19 56851464 missense possibly damaging 0.51
IGL01366:Tdrd1 APN 19 56855302 missense probably benign 0.00
IGL01569:Tdrd1 APN 19 56834409 missense probably damaging 1.00
IGL02691:Tdrd1 APN 19 56843852 missense probably damaging 0.99
3-1:Tdrd1 UTSW 19 56861695 missense probably benign
R0081:Tdrd1 UTSW 19 56831271 missense probably benign 0.16
R0139:Tdrd1 UTSW 19 56843198 missense probably benign 0.00
R0254:Tdrd1 UTSW 19 56842566 missense probably benign 0.02
R0686:Tdrd1 UTSW 19 56856051 missense probably damaging 1.00
R0735:Tdrd1 UTSW 19 56865978 nonsense probably null
R0740:Tdrd1 UTSW 19 56839099 missense probably damaging 1.00
R1241:Tdrd1 UTSW 19 56861760 missense probably benign
R1294:Tdrd1 UTSW 19 56848776 splice site probably null
R1508:Tdrd1 UTSW 19 56851358 missense probably damaging 1.00
R1655:Tdrd1 UTSW 19 56843216 nonsense probably null
R1708:Tdrd1 UTSW 19 56842289 missense probably benign 0.13
R1796:Tdrd1 UTSW 19 56837783 missense probably damaging 0.98
R1840:Tdrd1 UTSW 19 56842312 missense probably damaging 1.00
R2138:Tdrd1 UTSW 19 56842589 missense probably benign 0.30
R2201:Tdrd1 UTSW 19 56858661 missense probably benign 0.14
R2201:Tdrd1 UTSW 19 56858662 missense probably benign 0.00
R2286:Tdrd1 UTSW 19 56839119 missense probably benign 0.05
R2443:Tdrd1 UTSW 19 56841354 missense probably null 0.01
R3001:Tdrd1 UTSW 19 56861750 nonsense probably null
R3002:Tdrd1 UTSW 19 56861750 nonsense probably null
R3418:Tdrd1 UTSW 19 56831231 missense possibly damaging 0.87
R3419:Tdrd1 UTSW 19 56831231 missense possibly damaging 0.87
R3707:Tdrd1 UTSW 19 56865993 missense possibly damaging 0.86
R3978:Tdrd1 UTSW 19 56866634 missense probably benign 0.01
R4077:Tdrd1 UTSW 19 56831073 missense probably benign 0.22
R4083:Tdrd1 UTSW 19 56843230 missense probably benign
R4193:Tdrd1 UTSW 19 56851341 nonsense probably null
R6073:Tdrd1 UTSW 19 56843223 nonsense probably null
R6223:Tdrd1 UTSW 19 56865850 missense probably damaging 1.00
R6240:Tdrd1 UTSW 19 56841335 missense probably benign 0.00
R6953:Tdrd1 UTSW 19 56831371 missense probably damaging 0.98
R7090:Tdrd1 UTSW 19 56851401 missense probably benign 0.28
X0020:Tdrd1 UTSW 19 56856060 missense probably damaging 1.00
X0053:Tdrd1 UTSW 19 56865791 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GGACTTCTTTTGTCAGCAGCTG -3'
(R):5'- GGGAAGCATACACCACACTG -3'

Sequencing Primer
(F):5'- CTTTTGTCAGCAGCTGCAGAGC -3'
(R):5'- GCATACACCACACTGCTTTGATCTAG -3'
Posted On2017-02-10