Incidental Mutation 'R5883:Ubxn4'
ID454497
Institutional Source Beutler Lab
Gene Symbol Ubxn4
Ensembl Gene ENSMUSG00000026353
Gene NameUBX domain protein 4
SynonymsUbxd2, 1300013G12Rik
MMRRC Submission 044086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R5883 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location128243964-128279378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128256130 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 76 (C76S)
Ref Sequence ENSEMBL: ENSMUSP00000027592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027592] [ENSMUST00000190736]
Predicted Effect probably damaging
Transcript: ENSMUST00000027592
AA Change: C76S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027592
Gene: ENSMUSG00000026353
AA Change: C76S

DomainStartEndE-ValueType
coiled coil region 191 290 N/A INTRINSIC
UBX 309 393 5.63e-32 SMART
low complexity region 444 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187031
Predicted Effect probably benign
Transcript: ENSMUST00000190736
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.9%
  • 20x: 83.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UBXD2 is an integral membrane protein of the endoplasmic reticulum (ER) that binds valosin-containing protein (VCP; MIM 601023) and promotes ER-associated protein degradation (ERAD) (Liang et al., 2006 [PubMed 16968747]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,145,641 V103I probably damaging Het
Aass G A 6: 23,072,994 T920I probably benign Het
Akirin2 A G 4: 34,565,256 I168V possibly damaging Het
Ambn T A 5: 88,467,829 Y372* probably null Het
Ano3 T A 2: 110,880,864 E85V probably null Het
Bmf C T 2: 118,546,966 silent Het
Bmper T A 9: 23,406,674 S530T probably benign Het
Bop1 T C 15: 76,454,849 D383G probably damaging Het
Bub1b T A 2: 118,609,882 Y156N probably damaging Het
Cacna1h A G 17: 25,376,922 V1987A probably benign Het
Cd84 T C 1: 171,872,838 V174A possibly damaging Het
Cep290 T A 10: 100,523,399 L997Q probably benign Het
Chil4 C T 3: 106,210,570 R128H possibly damaging Het
Cpne3 A T 4: 19,552,314 V106D possibly damaging Het
D6Wsu163e A G 6: 126,966,916 E425G probably damaging Het
Dlgap1 A T 17: 70,517,013 probably benign Het
Dnhd1 C A 7: 105,720,504 H4379N probably damaging Het
Gm10309 A G 17: 86,498,757 probably benign Het
Gm6264 G A 1: 85,171,182 probably benign Het
Has2 T A 15: 56,668,063 I419F possibly damaging Het
Hscb A G 5: 110,839,578 C51R probably benign Het
Ighv1-61 T C 12: 115,359,563 S4G probably benign Het
Islr2 G T 9: 58,198,715 Q465K probably benign Het
Jakmip2 T C 18: 43,581,994 I156V possibly damaging Het
Klk1b24 A G 7: 44,190,363 I49V probably benign Het
Krt90 C T 15: 101,553,219 probably benign Het
Larp1 C T 11: 58,042,299 S243F probably damaging Het
Lrp4 T C 2: 91,488,433 Y872H probably benign Het
Maip1 T C 1: 57,407,101 M110T probably damaging Het
March7 G A 2: 60,234,442 R354Q probably damaging Het
Med12l G T 3: 59,091,468 E605D probably damaging Het
Nt5c1a T A 4: 123,216,256 probably null Het
Olfr209 A T 16: 59,361,715 C168S probably damaging Het
Olfr490 C T 7: 108,286,244 S294N probably damaging Het
Olfr531 T A 7: 140,400,188 Y286F probably damaging Het
Pdzd9 T A 7: 120,668,553 E13V possibly damaging Het
Ppip5k2 C T 1: 97,707,810 A1100T possibly damaging Het
Prkdc C A 16: 15,715,914 Q1539K probably benign Het
Rad54l C G 4: 116,099,046 probably benign Het
Ric1 T A 19: 29,595,989 I943N probably damaging Het
Rif1 T A 2: 52,105,639 probably null Het
Rpl12 T C 2: 32,962,524 probably benign Het
Ryr3 T C 2: 113,030,292 probably benign Het
Scarb1 C A 5: 125,340,907 probably benign Het
Sox10 T C 15: 79,156,263 E359G probably damaging Het
Taf5 A G 19: 47,067,789 T9A unknown Het
Tmem128 C T 5: 38,266,541 A33V possibly damaging Het
Tox A C 4: 6,697,444 V453G probably benign Het
Vmn2r100 A T 17: 19,523,524 Y483F probably benign Het
Xkr5 A G 8: 18,940,790 S154P probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Other mutations in Ubxn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Ubxn4 APN 1 128259465 missense possibly damaging 0.90
IGL02302:Ubxn4 APN 1 128256111 intron probably benign
IGL03066:Ubxn4 APN 1 128260854 unclassified probably null
E0370:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
P4748:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0008:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0086:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0087:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0220:Ubxn4 UTSW 1 128256194 missense possibly damaging 0.86
R0244:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0464:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0465:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0466:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0467:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R0658:Ubxn4 UTSW 1 128262904 missense probably benign 0.23
R1430:Ubxn4 UTSW 1 128274880 missense probably benign 0.03
R1623:Ubxn4 UTSW 1 128272851 missense possibly damaging 0.62
R1700:Ubxn4 UTSW 1 128252286 missense possibly damaging 0.89
R1764:Ubxn4 UTSW 1 128256179 missense probably damaging 1.00
R2128:Ubxn4 UTSW 1 128244510 missense probably benign
R2472:Ubxn4 UTSW 1 128272869 missense probably damaging 1.00
R4610:Ubxn4 UTSW 1 128255449 missense probably benign 0.03
R4651:Ubxn4 UTSW 1 128274850 missense probably benign 0.32
R4652:Ubxn4 UTSW 1 128274850 missense probably benign 0.32
R4804:Ubxn4 UTSW 1 128266404 nonsense probably null
R5735:Ubxn4 UTSW 1 128258940 missense possibly damaging 0.83
R5826:Ubxn4 UTSW 1 128266321 missense possibly damaging 0.80
R5840:Ubxn4 UTSW 1 128259525 missense possibly damaging 0.92
R6637:Ubxn4 UTSW 1 128277087 missense probably damaging 1.00
R6827:Ubxn4 UTSW 1 128276977 missense probably benign
R7092:Ubxn4 UTSW 1 128252222 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ACCACTTGCACTAGAGGCATG -3'
(R):5'- AACTTCAGTAGGGGCTATTCAGG -3'

Sequencing Primer
(F):5'- CCACTTGCACTAGAGGCATGATATG -3'
(R):5'- TTTGAACTCAGTACCTTGGGAAGAGC -3'
Posted On2017-02-10