Incidental Mutation 'R5883:Rpl12'
ID454499
Institutional Source Beutler Lab
Gene Symbol Rpl12
Ensembl Gene ENSMUSG00000038900
Gene Nameribosomal protein L12
Synonyms
MMRRC Submission 044086-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R5883 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32961559-32965345 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 32962524 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028132] [ENSMUST00000102811] [ENSMUST00000113200] [ENSMUST00000124492] [ENSMUST00000126610] [ENSMUST00000127321] [ENSMUST00000133832] [ENSMUST00000145578] [ENSMUST00000147528] [ENSMUST00000191838]
Predicted Effect probably benign
Transcript: ENSMUST00000028132
SMART Domains Protein: ENSMUSP00000028132
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083190
Predicted Effect probably benign
Transcript: ENSMUST00000102811
SMART Domains Protein: ENSMUSP00000141294
Gene: ENSMUSG00000038900

DomainStartEndE-ValueType
low complexity region 58 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113200
SMART Domains Protein: ENSMUSP00000108825
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR 103 125 9.3e-1 SMART
LRR 126 148 1.91e1 SMART
LRR 149 171 7.05e-1 SMART
Blast:IlGF 191 321 1e-71 BLAST
low complexity region 322 333 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
coiled coil region 500 547 N/A INTRINSIC
SAM 566 632 2.42e-2 SMART
RING 679 713 3.51e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125415
Predicted Effect probably benign
Transcript: ENSMUST00000126610
SMART Domains Protein: ENSMUSP00000117461
Gene: ENSMUSG00000038900

DomainStartEndE-ValueType
RL11 13 144 1.62e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127321
SMART Domains Protein: ENSMUSP00000115830
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR_TYP 103 126 1.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133832
SMART Domains Protein: ENSMUSP00000117194
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
LRR 80 102 1.26e1 SMART
LRR_TYP 103 126 1.79e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144644
Predicted Effect probably benign
Transcript: ENSMUST00000145578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145699
Predicted Effect probably benign
Transcript: ENSMUST00000147528
SMART Domains Protein: ENSMUSP00000122877
Gene: ENSMUSG00000026792

DomainStartEndE-ValueType
Pfam:LRR_1 32 52 8.9e-2 PFAM
LRR 80 102 1.26e1 SMART
LRR 103 124 3.75e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154340
Predicted Effect probably benign
Transcript: ENSMUST00000191838
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.9%
  • 20x: 83.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L11P family of ribosomal proteins. It is located in the cytoplasm. The protein binds directly to the 26S rRNA. This gene is co-transcribed with the U65 snoRNA, which is located in its fourth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,145,641 V103I probably damaging Het
Aass G A 6: 23,072,994 T920I probably benign Het
Akirin2 A G 4: 34,565,256 I168V possibly damaging Het
Ambn T A 5: 88,467,829 Y372* probably null Het
Ano3 T A 2: 110,880,864 E85V probably null Het
Bmf C T 2: 118,546,966 silent Het
Bmper T A 9: 23,406,674 S530T probably benign Het
Bop1 T C 15: 76,454,849 D383G probably damaging Het
Bub1b T A 2: 118,609,882 Y156N probably damaging Het
Cacna1h A G 17: 25,376,922 V1987A probably benign Het
Cd84 T C 1: 171,872,838 V174A possibly damaging Het
Cep290 T A 10: 100,523,399 L997Q probably benign Het
Chil4 C T 3: 106,210,570 R128H possibly damaging Het
Cpne3 A T 4: 19,552,314 V106D possibly damaging Het
D6Wsu163e A G 6: 126,966,916 E425G probably damaging Het
Dlgap1 A T 17: 70,517,013 probably benign Het
Dnhd1 C A 7: 105,720,504 H4379N probably damaging Het
Gm10309 A G 17: 86,498,757 probably benign Het
Gm6264 G A 1: 85,171,182 probably benign Het
Has2 T A 15: 56,668,063 I419F possibly damaging Het
Hscb A G 5: 110,839,578 C51R probably benign Het
Ighv1-61 T C 12: 115,359,563 S4G probably benign Het
Islr2 G T 9: 58,198,715 Q465K probably benign Het
Jakmip2 T C 18: 43,581,994 I156V possibly damaging Het
Klk1b24 A G 7: 44,190,363 I49V probably benign Het
Krt90 C T 15: 101,553,219 probably benign Het
Larp1 C T 11: 58,042,299 S243F probably damaging Het
Lrp4 T C 2: 91,488,433 Y872H probably benign Het
Maip1 T C 1: 57,407,101 M110T probably damaging Het
March7 G A 2: 60,234,442 R354Q probably damaging Het
Med12l G T 3: 59,091,468 E605D probably damaging Het
Nt5c1a T A 4: 123,216,256 probably null Het
Olfr209 A T 16: 59,361,715 C168S probably damaging Het
Olfr490 C T 7: 108,286,244 S294N probably damaging Het
Olfr531 T A 7: 140,400,188 Y286F probably damaging Het
Pdzd9 T A 7: 120,668,553 E13V possibly damaging Het
Ppip5k2 C T 1: 97,707,810 A1100T possibly damaging Het
Prkdc C A 16: 15,715,914 Q1539K probably benign Het
Rad54l C G 4: 116,099,046 probably benign Het
Ric1 T A 19: 29,595,989 I943N probably damaging Het
Rif1 T A 2: 52,105,639 probably null Het
Ryr3 T C 2: 113,030,292 probably benign Het
Scarb1 C A 5: 125,340,907 probably benign Het
Sox10 T C 15: 79,156,263 E359G probably damaging Het
Taf5 A G 19: 47,067,789 T9A unknown Het
Tmem128 C T 5: 38,266,541 A33V possibly damaging Het
Tox A C 4: 6,697,444 V453G probably benign Het
Ubxn4 T A 1: 128,256,130 C76S probably damaging Het
Vmn2r100 A T 17: 19,523,524 Y483F probably benign Het
Xkr5 A G 8: 18,940,790 S154P probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Other mutations in Rpl12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Rpl12 APN 2 32963747 missense probably benign 0.08
R1675:Rpl12 UTSW 2 32963525 missense probably benign 0.01
R4108:Rpl12 UTSW 2 32961824 missense probably damaging 0.96
R6237:Rpl12 UTSW 2 32962988 missense probably benign 0.01
Z1088:Rpl12 UTSW 2 32963019 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TAAATCCACTAGCCTCCGTGG -3'
(R):5'- GATTCCTGAGGGCTGCTATC -3'

Sequencing Primer
(F):5'- ACTAGCCTCCGTGGGTAAC -3'
(R):5'- TGAGGGCTGCTATCTCAACC -3'
Posted On2017-02-10