Incidental Mutation 'R5883:March7'
ID454501
Institutional Source Beutler Lab
Gene Symbol March7
Ensembl Gene ENSMUSG00000026977
Gene Namemembrane-associated ring finger (C3HC4) 7
SynonymsAxot, Gtrgeo17
MMRRC Submission 044086-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R5883 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location60209887-60250676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 60234442 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 354 (R354Q)
Ref Sequence ENSEMBL: ENSMUSP00000099809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067542] [ENSMUST00000102747] [ENSMUST00000102748]
Predicted Effect probably damaging
Transcript: ENSMUST00000067542
AA Change: R354Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068961
Gene: ENSMUSG00000026977
AA Change: R354Q

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
RINGv 553 610 2.11e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102747
AA Change: R354Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099808
Gene: ENSMUSG00000026977
AA Change: R354Q

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
RINGv 553 610 2.11e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102748
AA Change: R354Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099809
Gene: ENSMUSG00000026977
AA Change: R354Q

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
RINGv 553 610 2.11e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134905
Predicted Effect probably benign
Transcript: ENSMUST00000142485
SMART Domains Protein: ENSMUSP00000116925
Gene: ENSMUSG00000026977

DomainStartEndE-ValueType
RINGv 15 72 2.11e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143806
Meta Mutation Damage Score 0.49 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.9%
  • 20x: 83.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH7 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments (Bartee et al., 2004 [PubMed 14722266]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Homozygous null mice show premature neural degeneration and defective development of the corpus callosum. Both T cell proliferation and T cell-derived leukaemia inhibitory factor are increased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,145,641 V103I probably damaging Het
Aass G A 6: 23,072,994 T920I probably benign Het
Akirin2 A G 4: 34,565,256 I168V possibly damaging Het
Ambn T A 5: 88,467,829 Y372* probably null Het
Ano3 T A 2: 110,880,864 E85V probably null Het
Bmf C T 2: 118,546,966 silent Het
Bmper T A 9: 23,406,674 S530T probably benign Het
Bop1 T C 15: 76,454,849 D383G probably damaging Het
Bub1b T A 2: 118,609,882 Y156N probably damaging Het
Cacna1h A G 17: 25,376,922 V1987A probably benign Het
Cd84 T C 1: 171,872,838 V174A possibly damaging Het
Cep290 T A 10: 100,523,399 L997Q probably benign Het
Chil4 C T 3: 106,210,570 R128H possibly damaging Het
Cpne3 A T 4: 19,552,314 V106D possibly damaging Het
D6Wsu163e A G 6: 126,966,916 E425G probably damaging Het
Dlgap1 A T 17: 70,517,013 probably benign Het
Dnhd1 C A 7: 105,720,504 H4379N probably damaging Het
Gm10309 A G 17: 86,498,757 probably benign Het
Gm6264 G A 1: 85,171,182 probably benign Het
Has2 T A 15: 56,668,063 I419F possibly damaging Het
Hscb A G 5: 110,839,578 C51R probably benign Het
Ighv1-61 T C 12: 115,359,563 S4G probably benign Het
Islr2 G T 9: 58,198,715 Q465K probably benign Het
Jakmip2 T C 18: 43,581,994 I156V possibly damaging Het
Klk1b24 A G 7: 44,190,363 I49V probably benign Het
Krt90 C T 15: 101,553,219 probably benign Het
Larp1 C T 11: 58,042,299 S243F probably damaging Het
Lrp4 T C 2: 91,488,433 Y872H probably benign Het
Maip1 T C 1: 57,407,101 M110T probably damaging Het
Med12l G T 3: 59,091,468 E605D probably damaging Het
Nt5c1a T A 4: 123,216,256 probably null Het
Olfr209 A T 16: 59,361,715 C168S probably damaging Het
Olfr490 C T 7: 108,286,244 S294N probably damaging Het
Olfr531 T A 7: 140,400,188 Y286F probably damaging Het
Pdzd9 T A 7: 120,668,553 E13V possibly damaging Het
Ppip5k2 C T 1: 97,707,810 A1100T possibly damaging Het
Prkdc C A 16: 15,715,914 Q1539K probably benign Het
Rad54l C G 4: 116,099,046 probably benign Het
Ric1 T A 19: 29,595,989 I943N probably damaging Het
Rif1 T A 2: 52,105,639 probably null Het
Rpl12 T C 2: 32,962,524 probably benign Het
Ryr3 T C 2: 113,030,292 probably benign Het
Scarb1 C A 5: 125,340,907 probably benign Het
Sox10 T C 15: 79,156,263 E359G probably damaging Het
Taf5 A G 19: 47,067,789 T9A unknown Het
Tmem128 C T 5: 38,266,541 A33V possibly damaging Het
Tox A C 4: 6,697,444 V453G probably benign Het
Ubxn4 T A 1: 128,256,130 C76S probably damaging Het
Vmn2r100 A T 17: 19,523,524 Y483F probably benign Het
Xkr5 A G 8: 18,940,790 S154P probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Other mutations in March7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:March7 APN 2 60234195 missense probably benign 0.01
IGL02001:March7 APN 2 60234891 missense possibly damaging 0.95
IGL02927:March7 APN 2 60236918 missense probably damaging 1.00
PIT4687001:March7 UTSW 2 60232278 missense probably damaging 1.00
R0379:March7 UTSW 2 60234126 missense probably benign 0.00
R1722:March7 UTSW 2 60234182 missense probably damaging 1.00
R1755:March7 UTSW 2 60234921 missense probably benign
R1759:March7 UTSW 2 60234544 missense probably damaging 1.00
R1809:March7 UTSW 2 60232293 missense probably benign 0.16
R2018:March7 UTSW 2 60229040 nonsense probably null
R2226:March7 UTSW 2 60229846 missense probably benign 0.13
R2227:March7 UTSW 2 60229846 missense probably benign 0.13
R2471:March7 UTSW 2 60236900 missense possibly damaging 0.80
R3724:March7 UTSW 2 60229745 missense probably benign 0.10
R4349:March7 UTSW 2 60234195 missense probably benign 0.01
R4667:March7 UTSW 2 60241050 nonsense probably null
R5365:March7 UTSW 2 60233914 missense possibly damaging 0.48
R5524:March7 UTSW 2 60245303 intron probably benign
R5860:March7 UTSW 2 60236843 missense probably damaging 1.00
R5945:March7 UTSW 2 60240987 missense probably damaging 1.00
R5992:March7 UTSW 2 60245220 missense probably benign 0.14
R6937:March7 UTSW 2 60240966 missense probably damaging 1.00
R6944:March7 UTSW 2 60234243 missense probably benign 0.08
R6992:March7 UTSW 2 60229084 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTAGGAGATTGCTGTCACGG -3'
(R):5'- GACATTCTTGAAGACTCATCCCTTC -3'

Sequencing Primer
(F):5'- GCTGTCACGGATAGCTTCTAGC -3'
(R):5'- GAAGACTCATCCCTTCCCTCTCG -3'
Posted On2017-02-10