Incidental Mutation 'R5883:Tox'
ID454509
Institutional Source Beutler Lab
Gene Symbol Tox
Ensembl Gene ENSMUSG00000041272
Gene Namethymocyte selection-associated high mobility group box
Synonyms1700007F02Rik
MMRRC Submission 044086-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5883 (G1)
Quality Score89
Status Validated
Chromosome4
Chromosomal Location6686353-6991557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 6697444 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 453 (V453G)
Ref Sequence ENSEMBL: ENSMUSP00000037966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039987]
PDB Structure
Solution structure of the HMG_box domain of thymus high mobility group box protein TOX from mouse [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000039987
AA Change: V453G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037966
Gene: ENSMUSG00000041272
AA Change: V453G

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
HMG 260 330 1.11e-19 SMART
low complexity region 416 439 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137749
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.9%
  • 20x: 83.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a HMG box DNA binding domain. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. This protein may function to regulate T-cell development.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele have a severe block in thymic positive selection leading to loss of CD4 T lineage cells, and display decreased NK cell numbers, severely reduced numbers of lymphoid tissue inducer cells, absence of all peripheral lymph nodes, and loss of Peyer's patches. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,145,641 V103I probably damaging Het
Aass G A 6: 23,072,994 T920I probably benign Het
Akirin2 A G 4: 34,565,256 I168V possibly damaging Het
Ambn T A 5: 88,467,829 Y372* probably null Het
Ano3 T A 2: 110,880,864 E85V probably null Het
Bmf C T 2: 118,546,966 silent Het
Bmper T A 9: 23,406,674 S530T probably benign Het
Bop1 T C 15: 76,454,849 D383G probably damaging Het
Bub1b T A 2: 118,609,882 Y156N probably damaging Het
Cacna1h A G 17: 25,376,922 V1987A probably benign Het
Cd84 T C 1: 171,872,838 V174A possibly damaging Het
Cep290 T A 10: 100,523,399 L997Q probably benign Het
Chil4 C T 3: 106,210,570 R128H possibly damaging Het
Cpne3 A T 4: 19,552,314 V106D possibly damaging Het
D6Wsu163e A G 6: 126,966,916 E425G probably damaging Het
Dlgap1 A T 17: 70,517,013 probably benign Het
Dnhd1 C A 7: 105,720,504 H4379N probably damaging Het
Gm10309 A G 17: 86,498,757 probably benign Het
Gm6264 G A 1: 85,171,182 probably benign Het
Has2 T A 15: 56,668,063 I419F possibly damaging Het
Hscb A G 5: 110,839,578 C51R probably benign Het
Ighv1-61 T C 12: 115,359,563 S4G probably benign Het
Islr2 G T 9: 58,198,715 Q465K probably benign Het
Jakmip2 T C 18: 43,581,994 I156V possibly damaging Het
Klk1b24 A G 7: 44,190,363 I49V probably benign Het
Krt90 C T 15: 101,553,219 probably benign Het
Larp1 C T 11: 58,042,299 S243F probably damaging Het
Lrp4 T C 2: 91,488,433 Y872H probably benign Het
Maip1 T C 1: 57,407,101 M110T probably damaging Het
March7 G A 2: 60,234,442 R354Q probably damaging Het
Med12l G T 3: 59,091,468 E605D probably damaging Het
Nt5c1a T A 4: 123,216,256 probably null Het
Olfr209 A T 16: 59,361,715 C168S probably damaging Het
Olfr490 C T 7: 108,286,244 S294N probably damaging Het
Olfr531 T A 7: 140,400,188 Y286F probably damaging Het
Pdzd9 T A 7: 120,668,553 E13V possibly damaging Het
Ppip5k2 C T 1: 97,707,810 A1100T possibly damaging Het
Prkdc C A 16: 15,715,914 Q1539K probably benign Het
Rad54l C G 4: 116,099,046 probably benign Het
Ric1 T A 19: 29,595,989 I943N probably damaging Het
Rif1 T A 2: 52,105,639 probably null Het
Rpl12 T C 2: 32,962,524 probably benign Het
Ryr3 T C 2: 113,030,292 probably benign Het
Scarb1 C A 5: 125,340,907 probably benign Het
Sox10 T C 15: 79,156,263 E359G probably damaging Het
Taf5 A G 19: 47,067,789 T9A unknown Het
Tmem128 C T 5: 38,266,541 A33V possibly damaging Het
Ubxn4 T A 1: 128,256,130 C76S probably damaging Het
Vmn2r100 A T 17: 19,523,524 Y483F probably benign Het
Xkr5 A G 8: 18,940,790 S154P probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Other mutations in Tox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Tox APN 4 6697583 missense probably damaging 0.99
IGL01481:Tox APN 4 6842396 missense probably damaging 0.99
IGL01600:Tox APN 4 6697585 missense probably damaging 0.98
IGL01616:Tox APN 4 6688430 missense probably damaging 0.99
IGL02160:Tox APN 4 6711537 missense probably damaging 0.99
IGL02390:Tox APN 4 6697534 missense possibly damaging 0.90
IGL03243:Tox APN 4 6697597 missense possibly damaging 0.76
R0008:Tox UTSW 4 6842411 missense probably benign 0.41
R0008:Tox UTSW 4 6842411 missense probably benign 0.41
R1147:Tox UTSW 4 6823055 missense possibly damaging 0.74
R1147:Tox UTSW 4 6823055 missense possibly damaging 0.74
R1159:Tox UTSW 4 6697600 missense probably benign 0.37
R1903:Tox UTSW 4 6688948 missense probably damaging 0.99
R1961:Tox UTSW 4 6688886 missense probably damaging 0.96
R2484:Tox UTSW 4 6688886 missense probably damaging 0.96
R3692:Tox UTSW 4 6697535 missense probably benign 0.05
R4072:Tox UTSW 4 6842396 missense probably damaging 0.99
R4635:Tox UTSW 4 6990501 utr 5 prime probably benign
R4815:Tox UTSW 4 6823033 missense probably benign
R5099:Tox UTSW 4 6688958 missense probably benign 0.28
R5421:Tox UTSW 4 6842409 missense possibly damaging 0.79
R5537:Tox UTSW 4 6697510 missense probably damaging 1.00
R5630:Tox UTSW 4 6688835 small insertion probably benign
R6351:Tox UTSW 4 6697439 missense probably benign
R6351:Tox UTSW 4 6741536 missense probably benign 0.11
R6448:Tox UTSW 4 6822975 missense probably benign 0.08
R6934:Tox UTSW 4 6697635 missense probably damaging 0.98
Z1088:Tox UTSW 4 6688450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATTTTGACAACTTACCTCGTG -3'
(R):5'- AATGACTCCTCAGCTCACCG -3'

Sequencing Primer
(F):5'- TGGGCATTGCTCACTATC -3'
(R):5'- TCACCGCCATGCATCCGAG -3'
Posted On2017-02-10