Incidental Mutation 'R5883:Ambn'
ID454515
Institutional Source Beutler Lab
Gene Symbol Ambn
Ensembl Gene ENSMUSG00000029288
Gene Nameameloblastin
Synonyms
MMRRC Submission 044086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R5883 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location88455991-88468531 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 88467829 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 372 (Y372*)
Ref Sequence ENSEMBL: ENSMUSP00000142944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031226] [ENSMUST00000198265]
Predicted Effect probably null
Transcript: ENSMUST00000031226
AA Change: Y357*
SMART Domains Protein: ENSMUSP00000031226
Gene: ENSMUSG00000029288
AA Change: Y357*

DomainStartEndE-ValueType
Amelin 11 407 7.19e-250 SMART
Predicted Effect probably null
Transcript: ENSMUST00000198265
AA Change: Y372*
SMART Domains Protein: ENSMUSP00000142944
Gene: ENSMUSG00000029288
AA Change: Y372*

DomainStartEndE-ValueType
Amelin 11 422 8.22e-268 SMART
Meta Mutation Damage Score 0.586 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.9%
  • 20x: 83.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes an extracellular matrix glycoprotein that is involved in the formation of dental enamel. Mice lacking the encoded protein fail to undergo normal ameloblast differentiation and develop enamel. Mice overproducing the product of this gene develop thinner and more porous enamel, with disrupted rod patterns and abnormal crystallites. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice lack enamel and display abnormal ameloblast and tooth morphology and an increased incidence of dental epithelium derived tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,145,641 V103I probably damaging Het
Aass G A 6: 23,072,994 T920I probably benign Het
Akirin2 A G 4: 34,565,256 I168V possibly damaging Het
Ano3 T A 2: 110,880,864 E85V probably null Het
Bmf C T 2: 118,546,966 silent Het
Bmper T A 9: 23,406,674 S530T probably benign Het
Bop1 T C 15: 76,454,849 D383G probably damaging Het
Bub1b T A 2: 118,609,882 Y156N probably damaging Het
Cacna1h A G 17: 25,376,922 V1987A probably benign Het
Cd84 T C 1: 171,872,838 V174A possibly damaging Het
Cep290 T A 10: 100,523,399 L997Q probably benign Het
Chil4 C T 3: 106,210,570 R128H possibly damaging Het
Cpne3 A T 4: 19,552,314 V106D possibly damaging Het
D6Wsu163e A G 6: 126,966,916 E425G probably damaging Het
Dlgap1 A T 17: 70,517,013 probably benign Het
Dnhd1 C A 7: 105,720,504 H4379N probably damaging Het
Gm10309 A G 17: 86,498,757 probably benign Het
Gm6264 G A 1: 85,171,182 probably benign Het
Has2 T A 15: 56,668,063 I419F possibly damaging Het
Hscb A G 5: 110,839,578 C51R probably benign Het
Ighv1-61 T C 12: 115,359,563 S4G probably benign Het
Islr2 G T 9: 58,198,715 Q465K probably benign Het
Jakmip2 T C 18: 43,581,994 I156V possibly damaging Het
Klk1b24 A G 7: 44,190,363 I49V probably benign Het
Krt90 C T 15: 101,553,219 probably benign Het
Larp1 C T 11: 58,042,299 S243F probably damaging Het
Lrp4 T C 2: 91,488,433 Y872H probably benign Het
Maip1 T C 1: 57,407,101 M110T probably damaging Het
March7 G A 2: 60,234,442 R354Q probably damaging Het
Med12l G T 3: 59,091,468 E605D probably damaging Het
Nt5c1a T A 4: 123,216,256 probably null Het
Olfr209 A T 16: 59,361,715 C168S probably damaging Het
Olfr490 C T 7: 108,286,244 S294N probably damaging Het
Olfr531 T A 7: 140,400,188 Y286F probably damaging Het
Pdzd9 T A 7: 120,668,553 E13V possibly damaging Het
Ppip5k2 C T 1: 97,707,810 A1100T possibly damaging Het
Prkdc C A 16: 15,715,914 Q1539K probably benign Het
Rad54l C G 4: 116,099,046 probably benign Het
Ric1 T A 19: 29,595,989 I943N probably damaging Het
Rif1 T A 2: 52,105,639 probably null Het
Rpl12 T C 2: 32,962,524 probably benign Het
Ryr3 T C 2: 113,030,292 probably benign Het
Scarb1 C A 5: 125,340,907 probably benign Het
Sox10 T C 15: 79,156,263 E359G probably damaging Het
Taf5 A G 19: 47,067,789 T9A unknown Het
Tmem128 C T 5: 38,266,541 A33V possibly damaging Het
Tox A C 4: 6,697,444 V453G probably benign Het
Ubxn4 T A 1: 128,256,130 C76S probably damaging Het
Vmn2r100 A T 17: 19,523,524 Y483F probably benign Het
Xkr5 A G 8: 18,940,790 S154P probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Other mutations in Ambn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Ambn APN 5 88459359 missense probably damaging 0.99
IGL01139:Ambn APN 5 88464517 splice site probably benign
IGL01318:Ambn APN 5 88460695 splice site probably benign
IGL02139:Ambn APN 5 88465290 missense probably benign
IGL02261:Ambn APN 5 88456948 missense probably damaging 1.00
IGL02743:Ambn APN 5 88464484 missense probably damaging 0.99
IGL03329:Ambn APN 5 88461668 missense probably benign 0.34
R0242:Ambn UTSW 5 88467972 missense possibly damaging 0.85
R0242:Ambn UTSW 5 88467972 missense possibly damaging 0.85
R0563:Ambn UTSW 5 88463450 missense probably benign 0.28
R1649:Ambn UTSW 5 88464481 missense probably benign 0.16
R2118:Ambn UTSW 5 88460758 splice site probably benign
R2121:Ambn UTSW 5 88460758 splice site probably benign
R2124:Ambn UTSW 5 88460758 splice site probably benign
R2495:Ambn UTSW 5 88467804 missense probably benign 0.05
R2877:Ambn UTSW 5 88460700 splice site probably benign
R3779:Ambn UTSW 5 88465342 splice site probably benign
R4760:Ambn UTSW 5 88467707 missense probably damaging 1.00
R5422:Ambn UTSW 5 88464511 critical splice donor site probably null
R5755:Ambn UTSW 5 88464491 synonymous probably null
R5970:Ambn UTSW 5 88467951 missense possibly damaging 0.88
R6846:Ambn UTSW 5 88461715 missense possibly damaging 0.65
R7166:Ambn UTSW 5 88467528 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGAAGGTCCAGAAGGCTCTC -3'
(R):5'- CACAAAGTAGCTGCTATGTCAAG -3'

Sequencing Primer
(F):5'- GAAGGCTCTCCACTGCAAGAG -3'
(R):5'- CAAGGTTATCAGGGCTCTTGGAAAC -3'
Posted On2017-02-10