Incidental Mutation 'R5883:Hscb'
ID454516
Institutional Source Beutler Lab
Gene Symbol Hscb
Ensembl Gene ENSMUSG00000043510
Gene NameHscB iron-sulfur cluster co-chaperone
Synonyms
MMRRC Submission 044086-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R5883 (G1)
Quality Score91
Status Validated
Chromosome5
Chromosomal Location110829070-110839777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110839578 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 51 (C51R)
Ref Sequence ENSEMBL: ENSMUSP00000062811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056937] [ENSMUST00000066160] [ENSMUST00000145318] [ENSMUST00000198373] [ENSMUST00000199937] [ENSMUST00000200172]
Predicted Effect probably benign
Transcript: ENSMUST00000056937
AA Change: C51R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062811
Gene: ENSMUSG00000043510
AA Change: C51R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
DnaJ 70 135 6.53e-3 SMART
Pfam:HSCB_C 156 228 9.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066160
SMART Domains Protein: ENSMUSP00000066679
Gene: ENSMUSG00000029521

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 5.14e-3 SMART
S_TKc 224 490 7.35e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122921
Predicted Effect probably benign
Transcript: ENSMUST00000144850
Predicted Effect probably benign
Transcript: ENSMUST00000145318
SMART Domains Protein: ENSMUSP00000120926
Gene: ENSMUSG00000043510

DomainStartEndE-ValueType
DnaJ 19 84 6.53e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198373
Predicted Effect probably benign
Transcript: ENSMUST00000199937
SMART Domains Protein: ENSMUSP00000143558
Gene: ENSMUSG00000029521

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 2.6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200630
Meta Mutation Damage Score 0.0964 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.9%
  • 20x: 83.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DnaJ-type co-chaperone and member of the heat shock cognate B (HscB) family of proteins. The encoded protein plays a role in the synthesis of iron-sulfur clusters, protein cofactors that are involved in the redox reactions of mitochondrial electron transport and other processes. Cells in which this gene is knocked down exhibit reduced activity of iron-sulfur cluster-dependent enzymes including succinate dehydrogenase and aconitase. The encoded protein may stimulate the ATPase activity of the mitochondrial stress-70 protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,145,641 V103I probably damaging Het
Aass G A 6: 23,072,994 T920I probably benign Het
Akirin2 A G 4: 34,565,256 I168V possibly damaging Het
Ambn T A 5: 88,467,829 Y372* probably null Het
Ano3 T A 2: 110,880,864 E85V probably null Het
Bmf C T 2: 118,546,966 silent Het
Bmper T A 9: 23,406,674 S530T probably benign Het
Bop1 T C 15: 76,454,849 D383G probably damaging Het
Bub1b T A 2: 118,609,882 Y156N probably damaging Het
Cacna1h A G 17: 25,376,922 V1987A probably benign Het
Cd84 T C 1: 171,872,838 V174A possibly damaging Het
Cep290 T A 10: 100,523,399 L997Q probably benign Het
Chil4 C T 3: 106,210,570 R128H possibly damaging Het
Cpne3 A T 4: 19,552,314 V106D possibly damaging Het
D6Wsu163e A G 6: 126,966,916 E425G probably damaging Het
Dlgap1 A T 17: 70,517,013 probably benign Het
Dnhd1 C A 7: 105,720,504 H4379N probably damaging Het
Gm10309 A G 17: 86,498,757 probably benign Het
Gm6264 G A 1: 85,171,182 probably benign Het
Has2 T A 15: 56,668,063 I419F possibly damaging Het
Ighv1-61 T C 12: 115,359,563 S4G probably benign Het
Islr2 G T 9: 58,198,715 Q465K probably benign Het
Jakmip2 T C 18: 43,581,994 I156V possibly damaging Het
Klk1b24 A G 7: 44,190,363 I49V probably benign Het
Krt90 C T 15: 101,553,219 probably benign Het
Larp1 C T 11: 58,042,299 S243F probably damaging Het
Lrp4 T C 2: 91,488,433 Y872H probably benign Het
Maip1 T C 1: 57,407,101 M110T probably damaging Het
March7 G A 2: 60,234,442 R354Q probably damaging Het
Med12l G T 3: 59,091,468 E605D probably damaging Het
Nt5c1a T A 4: 123,216,256 probably null Het
Olfr209 A T 16: 59,361,715 C168S probably damaging Het
Olfr490 C T 7: 108,286,244 S294N probably damaging Het
Olfr531 T A 7: 140,400,188 Y286F probably damaging Het
Pdzd9 T A 7: 120,668,553 E13V possibly damaging Het
Ppip5k2 C T 1: 97,707,810 A1100T possibly damaging Het
Prkdc C A 16: 15,715,914 Q1539K probably benign Het
Rad54l C G 4: 116,099,046 probably benign Het
Ric1 T A 19: 29,595,989 I943N probably damaging Het
Rif1 T A 2: 52,105,639 probably null Het
Rpl12 T C 2: 32,962,524 probably benign Het
Ryr3 T C 2: 113,030,292 probably benign Het
Scarb1 C A 5: 125,340,907 probably benign Het
Sox10 T C 15: 79,156,263 E359G probably damaging Het
Taf5 A G 19: 47,067,789 T9A unknown Het
Tmem128 C T 5: 38,266,541 A33V possibly damaging Het
Tox A C 4: 6,697,444 V453G probably benign Het
Ubxn4 T A 1: 128,256,130 C76S probably damaging Het
Vmn2r100 A T 17: 19,523,524 Y483F probably benign Het
Xkr5 A G 8: 18,940,790 S154P probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Other mutations in Hscb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Hscb APN 5 110830954 missense probably benign 0.00
IGL02170:Hscb APN 5 110839626 missense probably damaging 1.00
potsticker UTSW 5 110834792 missense probably damaging 1.00
PIT4520001:Hscb UTSW 5 110835985 missense probably damaging 1.00
R0277:Hscb UTSW 5 110834690 missense possibly damaging 0.91
R0323:Hscb UTSW 5 110834690 missense possibly damaging 0.91
R1873:Hscb UTSW 5 110830957 missense probably benign
R1940:Hscb UTSW 5 110836060 missense probably benign
R3821:Hscb UTSW 5 110836328 missense probably damaging 1.00
R5294:Hscb UTSW 5 110834792 missense probably damaging 1.00
R6337:Hscb UTSW 5 110839494 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTACTACTTATACCTATGGCCTAC -3'
(R):5'- TTGCTACCTAGGTCAGCGAG -3'

Sequencing Primer
(F):5'- GAATCAGTCTCGGCAAATTGC -3'
(R):5'- TAGGTCAGCGAGCGGCC -3'
Posted On2017-02-10