Incidental Mutation 'R5883:Klk1b24'
ID454519
Institutional Source Beutler Lab
Gene Symbol Klk1b24
Ensembl Gene ENSMUSG00000063713
Gene Namekallikrein 1-related peptidase b24
SynonymsmGk-24, Klk24
MMRRC Submission 044086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.032) question?
Stock #R5883 (G1)
Quality Score160
Status Validated
Chromosome7
Chromosomal Location44188236-44192455 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44190363 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 49 (I49V)
Ref Sequence ENSEMBL: ENSMUSP00000073392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073713]
Predicted Effect probably benign
Transcript: ENSMUST00000073713
AA Change: I49V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073392
Gene: ENSMUSG00000063713
AA Change: I49V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 255 1.22e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206937
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.9%
  • 20x: 83.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,145,641 V103I probably damaging Het
Aass G A 6: 23,072,994 T920I probably benign Het
Akirin2 A G 4: 34,565,256 I168V possibly damaging Het
Ambn T A 5: 88,467,829 Y372* probably null Het
Ano3 T A 2: 110,880,864 E85V probably null Het
Bmf C T 2: 118,546,966 silent Het
Bmper T A 9: 23,406,674 S530T probably benign Het
Bop1 T C 15: 76,454,849 D383G probably damaging Het
Bub1b T A 2: 118,609,882 Y156N probably damaging Het
Cacna1h A G 17: 25,376,922 V1987A probably benign Het
Cd84 T C 1: 171,872,838 V174A possibly damaging Het
Cep290 T A 10: 100,523,399 L997Q probably benign Het
Chil4 C T 3: 106,210,570 R128H possibly damaging Het
Cpne3 A T 4: 19,552,314 V106D possibly damaging Het
D6Wsu163e A G 6: 126,966,916 E425G probably damaging Het
Dlgap1 A T 17: 70,517,013 probably benign Het
Dnhd1 C A 7: 105,720,504 H4379N probably damaging Het
Gm10309 A G 17: 86,498,757 probably benign Het
Gm6264 G A 1: 85,171,182 probably benign Het
Has2 T A 15: 56,668,063 I419F possibly damaging Het
Hscb A G 5: 110,839,578 C51R probably benign Het
Ighv1-61 T C 12: 115,359,563 S4G probably benign Het
Islr2 G T 9: 58,198,715 Q465K probably benign Het
Jakmip2 T C 18: 43,581,994 I156V possibly damaging Het
Krt90 C T 15: 101,553,219 probably benign Het
Larp1 C T 11: 58,042,299 S243F probably damaging Het
Lrp4 T C 2: 91,488,433 Y872H probably benign Het
Maip1 T C 1: 57,407,101 M110T probably damaging Het
March7 G A 2: 60,234,442 R354Q probably damaging Het
Med12l G T 3: 59,091,468 E605D probably damaging Het
Nt5c1a T A 4: 123,216,256 probably null Het
Olfr209 A T 16: 59,361,715 C168S probably damaging Het
Olfr490 C T 7: 108,286,244 S294N probably damaging Het
Olfr531 T A 7: 140,400,188 Y286F probably damaging Het
Pdzd9 T A 7: 120,668,553 E13V possibly damaging Het
Ppip5k2 C T 1: 97,707,810 A1100T possibly damaging Het
Prkdc C A 16: 15,715,914 Q1539K probably benign Het
Rad54l C G 4: 116,099,046 probably benign Het
Ric1 T A 19: 29,595,989 I943N probably damaging Het
Rif1 T A 2: 52,105,639 probably null Het
Rpl12 T C 2: 32,962,524 probably benign Het
Ryr3 T C 2: 113,030,292 probably benign Het
Scarb1 C A 5: 125,340,907 probably benign Het
Sox10 T C 15: 79,156,263 E359G probably damaging Het
Taf5 A G 19: 47,067,789 T9A unknown Het
Tmem128 C T 5: 38,266,541 A33V possibly damaging Het
Tox A C 4: 6,697,444 V453G probably benign Het
Ubxn4 T A 1: 128,256,130 C76S probably damaging Het
Vmn2r100 A T 17: 19,523,524 Y483F probably benign Het
Xkr5 A G 8: 18,940,790 S154P probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Other mutations in Klk1b24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01994:Klk1b24 APN 7 44191633 missense probably damaging 0.96
IGL02394:Klk1b24 APN 7 44191870 missense possibly damaging 0.65
IGL02500:Klk1b24 APN 7 44188324 splice site probably benign
IGL03030:Klk1b24 APN 7 44191366 missense probably benign
R1458:Klk1b24 UTSW 7 44191466 missense possibly damaging 0.49
R1465:Klk1b24 UTSW 7 44191361 missense probably benign 0.24
R1465:Klk1b24 UTSW 7 44191361 missense probably benign 0.24
R1714:Klk1b24 UTSW 7 44191515 missense probably damaging 1.00
R1771:Klk1b24 UTSW 7 44188229 unclassified probably null
R1791:Klk1b24 UTSW 7 44190428 splice site probably null
R3690:Klk1b24 UTSW 7 44191819 missense probably benign
R4726:Klk1b24 UTSW 7 44190396 missense probably damaging 1.00
R5654:Klk1b24 UTSW 7 44191465 missense probably benign 0.00
R6775:Klk1b24 UTSW 7 44191465 missense probably benign 0.05
R7083:Klk1b24 UTSW 7 44191801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATCCCAGCAGTGCTTAAC -3'
(R):5'- TCTGAACACAAATCTGGAGGG -3'

Sequencing Primer
(F):5'- TAACTGTGTCCATCAAGGGTTGACC -3'
(R):5'- TCAAGGAGGTCATGGATAGACTTTC -3'
Posted On2017-02-10