Incidental Mutation 'R5883:Olfr490'
ID454521
Institutional Source Beutler Lab
Gene Symbol Olfr490
Ensembl Gene ENSMUSG00000109884
Gene Nameolfactory receptor 490
SynonymsMOR204-17, GA_x6K02T2PBJ9-10617173-10616229
MMRRC Submission 044086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R5883 (G1)
Quality Score209
Status Validated
Chromosome7
Chromosomal Location108285893-108288934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108286244 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 294 (S294N)
Ref Sequence ENSEMBL: ENSMUSP00000147922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000210114] [ENSMUST00000211345]
Predicted Effect probably damaging
Transcript: ENSMUST00000074550
AA Change: S294N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074137
Gene: ENSMUSG00000093808
AA Change: S294N

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 4e-53 PFAM
Pfam:7tm_1 44 293 5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210114
AA Change: S294N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211345
AA Change: S294N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.9%
  • 20x: 83.7%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,145,641 V103I probably damaging Het
Aass G A 6: 23,072,994 T920I probably benign Het
Akirin2 A G 4: 34,565,256 I168V possibly damaging Het
Ambn T A 5: 88,467,829 Y372* probably null Het
Ano3 T A 2: 110,880,864 E85V probably null Het
Bmf C T 2: 118,546,966 silent Het
Bmper T A 9: 23,406,674 S530T probably benign Het
Bop1 T C 15: 76,454,849 D383G probably damaging Het
Bub1b T A 2: 118,609,882 Y156N probably damaging Het
Cacna1h A G 17: 25,376,922 V1987A probably benign Het
Cd84 T C 1: 171,872,838 V174A possibly damaging Het
Cep290 T A 10: 100,523,399 L997Q probably benign Het
Chil4 C T 3: 106,210,570 R128H possibly damaging Het
Cpne3 A T 4: 19,552,314 V106D possibly damaging Het
D6Wsu163e A G 6: 126,966,916 E425G probably damaging Het
Dlgap1 A T 17: 70,517,013 probably benign Het
Dnhd1 C A 7: 105,720,504 H4379N probably damaging Het
Gm10309 A G 17: 86,498,757 probably benign Het
Gm6264 G A 1: 85,171,182 probably benign Het
Has2 T A 15: 56,668,063 I419F possibly damaging Het
Hscb A G 5: 110,839,578 C51R probably benign Het
Ighv1-61 T C 12: 115,359,563 S4G probably benign Het
Islr2 G T 9: 58,198,715 Q465K probably benign Het
Jakmip2 T C 18: 43,581,994 I156V possibly damaging Het
Klk1b24 A G 7: 44,190,363 I49V probably benign Het
Krt90 C T 15: 101,553,219 probably benign Het
Larp1 C T 11: 58,042,299 S243F probably damaging Het
Lrp4 T C 2: 91,488,433 Y872H probably benign Het
Maip1 T C 1: 57,407,101 M110T probably damaging Het
March7 G A 2: 60,234,442 R354Q probably damaging Het
Med12l G T 3: 59,091,468 E605D probably damaging Het
Nt5c1a T A 4: 123,216,256 probably null Het
Olfr209 A T 16: 59,361,715 C168S probably damaging Het
Olfr531 T A 7: 140,400,188 Y286F probably damaging Het
Pdzd9 T A 7: 120,668,553 E13V possibly damaging Het
Ppip5k2 C T 1: 97,707,810 A1100T possibly damaging Het
Prkdc C A 16: 15,715,914 Q1539K probably benign Het
Rad54l C G 4: 116,099,046 probably benign Het
Ric1 T A 19: 29,595,989 I943N probably damaging Het
Rif1 T A 2: 52,105,639 probably null Het
Rpl12 T C 2: 32,962,524 probably benign Het
Ryr3 T C 2: 113,030,292 probably benign Het
Scarb1 C A 5: 125,340,907 probably benign Het
Sox10 T C 15: 79,156,263 E359G probably damaging Het
Taf5 A G 19: 47,067,789 T9A unknown Het
Tmem128 C T 5: 38,266,541 A33V possibly damaging Het
Tox A C 4: 6,697,444 V453G probably benign Het
Ubxn4 T A 1: 128,256,130 C76S probably damaging Het
Vmn2r100 A T 17: 19,523,524 Y483F probably benign Het
Xkr5 A G 8: 18,940,790 S154P probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Other mutations in Olfr490
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0395:Olfr490 UTSW 7 108286271 missense probably benign 0.00
R0634:Olfr490 UTSW 7 108286296 missense probably benign 0.00
R0940:Olfr490 UTSW 7 108287057 missense probably benign 0.01
R1990:Olfr490 UTSW 7 108286359 nonsense probably null
R1991:Olfr490 UTSW 7 108286359 nonsense probably null
R2860:Olfr490 UTSW 7 108286962 missense probably damaging 0.98
R2861:Olfr490 UTSW 7 108286962 missense probably damaging 0.98
R3712:Olfr490 UTSW 7 108286456 nonsense probably null
R4735:Olfr490 UTSW 7 108286313 missense probably benign
R4895:Olfr490 UTSW 7 108286595 missense probably damaging 0.97
R4976:Olfr490 UTSW 7 108286611 missense probably damaging 1.00
R5686:Olfr490 UTSW 7 108286742 missense probably damaging 1.00
R5719:Olfr490 UTSW 7 108286392 missense probably damaging 0.97
R5911:Olfr490 UTSW 7 108286398 missense probably damaging 1.00
R6452:Olfr490 UTSW 7 108286893 missense probably damaging 1.00
R7018:Olfr490 UTSW 7 108286344 missense probably benign 0.34
R7233:Olfr490 UTSW 7 108286716 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TTTACTACCAAACTCAAAGCCTGG -3'
(R):5'- TCAAGATGCGTTCCACTGAAGG -3'

Sequencing Primer
(F):5'- CTCAAAGCCTGGTTAAATTTGGATC -3'
(R):5'- TTCCACTGAAGGTCGCCAGAAAG -3'
Posted On2017-02-10