Incidental Mutation 'R5883:Xkr5'
ID454524
Institutional Source Beutler Lab
Gene Symbol Xkr5
Ensembl Gene ENSMUSG00000039814
Gene NameX-linked Kx blood group related 5
Synonyms
MMRRC Submission 044086-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5883 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location18932729-18950975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18940790 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 154 (S154P)
Ref Sequence ENSEMBL: ENSMUSP00000093089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055503] [ENSMUST00000095438] [ENSMUST00000143913] [ENSMUST00000152974]
Predicted Effect probably benign
Transcript: ENSMUST00000055503
SMART Domains Protein: ENSMUSP00000061748
Gene: ENSMUSG00000039814

DomainStartEndE-ValueType
Pfam:XK-related 1 155 1.4e-46 PFAM
low complexity region 240 247 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095438
AA Change: S154P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093089
Gene: ENSMUSG00000039814
AA Change: S154P

DomainStartEndE-ValueType
Pfam:XK-related 5 321 1.6e-87 PFAM
low complexity region 406 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143913
SMART Domains Protein: ENSMUSP00000121958
Gene: ENSMUSG00000039814

DomainStartEndE-ValueType
Pfam:XK-related 2 109 2.8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144987
Predicted Effect probably benign
Transcript: ENSMUST00000152974
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.9%
  • 20x: 83.7%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,145,641 V103I probably damaging Het
Aass G A 6: 23,072,994 T920I probably benign Het
Akirin2 A G 4: 34,565,256 I168V possibly damaging Het
Ambn T A 5: 88,467,829 Y372* probably null Het
Ano3 T A 2: 110,880,864 E85V probably null Het
Bmf C T 2: 118,546,966 silent Het
Bmper T A 9: 23,406,674 S530T probably benign Het
Bop1 T C 15: 76,454,849 D383G probably damaging Het
Bub1b T A 2: 118,609,882 Y156N probably damaging Het
Cacna1h A G 17: 25,376,922 V1987A probably benign Het
Cd84 T C 1: 171,872,838 V174A possibly damaging Het
Cep290 T A 10: 100,523,399 L997Q probably benign Het
Chil4 C T 3: 106,210,570 R128H possibly damaging Het
Cpne3 A T 4: 19,552,314 V106D possibly damaging Het
D6Wsu163e A G 6: 126,966,916 E425G probably damaging Het
Dlgap1 A T 17: 70,517,013 probably benign Het
Dnhd1 C A 7: 105,720,504 H4379N probably damaging Het
Gm10309 A G 17: 86,498,757 probably benign Het
Gm6264 G A 1: 85,171,182 probably benign Het
Has2 T A 15: 56,668,063 I419F possibly damaging Het
Hscb A G 5: 110,839,578 C51R probably benign Het
Ighv1-61 T C 12: 115,359,563 S4G probably benign Het
Islr2 G T 9: 58,198,715 Q465K probably benign Het
Jakmip2 T C 18: 43,581,994 I156V possibly damaging Het
Klk1b24 A G 7: 44,190,363 I49V probably benign Het
Krt90 C T 15: 101,553,219 probably benign Het
Larp1 C T 11: 58,042,299 S243F probably damaging Het
Lrp4 T C 2: 91,488,433 Y872H probably benign Het
Maip1 T C 1: 57,407,101 M110T probably damaging Het
March7 G A 2: 60,234,442 R354Q probably damaging Het
Med12l G T 3: 59,091,468 E605D probably damaging Het
Nt5c1a T A 4: 123,216,256 probably null Het
Olfr209 A T 16: 59,361,715 C168S probably damaging Het
Olfr490 C T 7: 108,286,244 S294N probably damaging Het
Olfr531 T A 7: 140,400,188 Y286F probably damaging Het
Pdzd9 T A 7: 120,668,553 E13V possibly damaging Het
Ppip5k2 C T 1: 97,707,810 A1100T possibly damaging Het
Prkdc C A 16: 15,715,914 Q1539K probably benign Het
Rad54l C G 4: 116,099,046 probably benign Het
Ric1 T A 19: 29,595,989 I943N probably damaging Het
Rif1 T A 2: 52,105,639 probably null Het
Rpl12 T C 2: 32,962,524 probably benign Het
Ryr3 T C 2: 113,030,292 probably benign Het
Scarb1 C A 5: 125,340,907 probably benign Het
Sox10 T C 15: 79,156,263 E359G probably damaging Het
Taf5 A G 19: 47,067,789 T9A unknown Het
Tmem128 C T 5: 38,266,541 A33V possibly damaging Het
Tox A C 4: 6,697,444 V453G probably benign Het
Ubxn4 T A 1: 128,256,130 C76S probably damaging Het
Vmn2r100 A T 17: 19,523,524 Y483F probably benign Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Other mutations in Xkr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01505:Xkr5 APN 8 18933498 missense probably damaging 1.00
IGL02153:Xkr5 APN 8 18933667 missense probably benign 0.09
IGL02637:Xkr5 APN 8 18934083 missense probably benign 0.00
IGL02968:Xkr5 APN 8 18933625 missense probably benign 0.13
IGL02983:Xkr5 APN 8 18933832 missense probably benign 0.00
IGL03222:Xkr5 APN 8 18937299 missense probably damaging 0.98
PIT4431001:Xkr5 UTSW 8 18934345 missense possibly damaging 0.67
R0336:Xkr5 UTSW 8 18940636 missense possibly damaging 0.93
R0638:Xkr5 UTSW 8 18933547 missense probably benign 0.00
R1644:Xkr5 UTSW 8 18934125 missense probably benign 0.03
R1703:Xkr5 UTSW 8 18939118 missense probably benign 0.15
R1777:Xkr5 UTSW 8 18939132 missense probably benign 0.33
R1972:Xkr5 UTSW 8 18941981 missense probably damaging 1.00
R3715:Xkr5 UTSW 8 18934458 missense probably benign 0.03
R4274:Xkr5 UTSW 8 18934167 missense probably benign 0.00
R4603:Xkr5 UTSW 8 18933717 missense possibly damaging 0.70
R4742:Xkr5 UTSW 8 18948730 makesense probably null
R5019:Xkr5 UTSW 8 18942110 missense probably benign 0.00
R5103:Xkr5 UTSW 8 18933643 missense probably benign 0.00
R5331:Xkr5 UTSW 8 18933468 utr 3 prime probably benign
R5649:Xkr5 UTSW 8 18933966 missense probably benign 0.00
R6005:Xkr5 UTSW 8 18934505 missense probably benign 0.00
R6393:Xkr5 UTSW 8 18948700 missense probably damaging 1.00
R6615:Xkr5 UTSW 8 18933553 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACCAGCAACAGATCTGGGAC -3'
(R):5'- TGTTAAGTTACCCACCACCAAGG -3'

Sequencing Primer
(F):5'- CTTTATGAATAGAGTGGAAGCCCC -3'
(R):5'- CACCACCAAGGGAATCAGTC -3'
Posted On2017-02-10