Incidental Mutation 'R5883:Islr2'
ID454527
Institutional Source Beutler Lab
Gene Symbol Islr2
Ensembl Gene ENSMUSG00000051243
Gene Nameimmunoglobulin superfamily containing leucine-rich repeat 2
SynonymsLinx, mbu-3, B930052A04Rik
MMRRC Submission 044086-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5883 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58196297-58204319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58198715 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 465 (Q465K)
Ref Sequence ENSEMBL: ENSMUSP00000130879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114144] [ENSMUST00000163200] [ENSMUST00000163897] [ENSMUST00000165276] [ENSMUST00000170421] [ENSMUST00000214647] [ENSMUST00000214649] [ENSMUST00000215950] [ENSMUST00000216231] [ENSMUST00000216297] [ENSMUST00000217050] [ENSMUST00000217427] [ENSMUST00000217512] [ENSMUST00000217578]
Predicted Effect probably benign
Transcript: ENSMUST00000114144
AA Change: Q421K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109781
Gene: ENSMUSG00000051243
AA Change: Q421K

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163200
AA Change: Q465K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130879
Gene: ENSMUSG00000051243
AA Change: Q465K

DomainStartEndE-ValueType
LRRNT 63 99 1.1e-1 SMART
LRR 93 117 8.24e0 SMART
LRR 142 165 1.91e1 SMART
LRR 166 189 3.07e-1 SMART
LRR_TYP 190 213 1.58e-3 SMART
LRRCT 225 275 2.36e-12 SMART
IG 289 418 2.99e-2 SMART
low complexity region 554 579 N/A INTRINSIC
transmembrane domain 635 657 N/A INTRINSIC
low complexity region 706 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163897
AA Change: Q421K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000130322
Gene: ENSMUSG00000051243
AA Change: Q421K

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165276
AA Change: Q421K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000129328
Gene: ENSMUSG00000051243
AA Change: Q421K

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170421
AA Change: Q421K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000127228
Gene: ENSMUSG00000051243
AA Change: Q421K

DomainStartEndE-ValueType
LRRNT 19 55 1.1e-1 SMART
LRR 49 73 8.24e0 SMART
LRR 98 121 1.91e1 SMART
LRR 122 145 3.07e-1 SMART
LRR_TYP 146 169 1.58e-3 SMART
LRRCT 181 231 2.36e-12 SMART
IG 245 374 2.99e-2 SMART
low complexity region 510 535 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
low complexity region 662 682 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213495
Predicted Effect probably benign
Transcript: ENSMUST00000214647
Predicted Effect probably benign
Transcript: ENSMUST00000214649
Predicted Effect probably benign
Transcript: ENSMUST00000215950
AA Change: Q421K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000216231
Predicted Effect probably benign
Transcript: ENSMUST00000216297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216359
Predicted Effect probably benign
Transcript: ENSMUST00000217050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217158
Predicted Effect probably benign
Transcript: ENSMUST00000217427
Predicted Effect probably benign
Transcript: ENSMUST00000217512
Predicted Effect probably benign
Transcript: ENSMUST00000217578
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.9%
  • 20x: 83.7%
Validation Efficiency 100% (70/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit perinatal lethality, absent tail pinch response, and defective peroneal and tibial nerve morphology and branch extension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,145,641 V103I probably damaging Het
Aass G A 6: 23,072,994 T920I probably benign Het
Akirin2 A G 4: 34,565,256 I168V possibly damaging Het
Ambn T A 5: 88,467,829 Y372* probably null Het
Ano3 T A 2: 110,880,864 E85V probably null Het
Bmf C T 2: 118,546,966 silent Het
Bmper T A 9: 23,406,674 S530T probably benign Het
Bop1 T C 15: 76,454,849 D383G probably damaging Het
Bub1b T A 2: 118,609,882 Y156N probably damaging Het
Cacna1h A G 17: 25,376,922 V1987A probably benign Het
Cd84 T C 1: 171,872,838 V174A possibly damaging Het
Cep290 T A 10: 100,523,399 L997Q probably benign Het
Chil4 C T 3: 106,210,570 R128H possibly damaging Het
Cpne3 A T 4: 19,552,314 V106D possibly damaging Het
D6Wsu163e A G 6: 126,966,916 E425G probably damaging Het
Dlgap1 A T 17: 70,517,013 probably benign Het
Dnhd1 C A 7: 105,720,504 H4379N probably damaging Het
Gm10309 A G 17: 86,498,757 probably benign Het
Gm6264 G A 1: 85,171,182 probably benign Het
Has2 T A 15: 56,668,063 I419F possibly damaging Het
Hscb A G 5: 110,839,578 C51R probably benign Het
Ighv1-61 T C 12: 115,359,563 S4G probably benign Het
Jakmip2 T C 18: 43,581,994 I156V possibly damaging Het
Klk1b24 A G 7: 44,190,363 I49V probably benign Het
Krt90 C T 15: 101,553,219 probably benign Het
Larp1 C T 11: 58,042,299 S243F probably damaging Het
Lrp4 T C 2: 91,488,433 Y872H probably benign Het
Maip1 T C 1: 57,407,101 M110T probably damaging Het
March7 G A 2: 60,234,442 R354Q probably damaging Het
Med12l G T 3: 59,091,468 E605D probably damaging Het
Nt5c1a T A 4: 123,216,256 probably null Het
Olfr209 A T 16: 59,361,715 C168S probably damaging Het
Olfr490 C T 7: 108,286,244 S294N probably damaging Het
Olfr531 T A 7: 140,400,188 Y286F probably damaging Het
Pdzd9 T A 7: 120,668,553 E13V possibly damaging Het
Ppip5k2 C T 1: 97,707,810 A1100T possibly damaging Het
Prkdc C A 16: 15,715,914 Q1539K probably benign Het
Rad54l C G 4: 116,099,046 probably benign Het
Ric1 T A 19: 29,595,989 I943N probably damaging Het
Rif1 T A 2: 52,105,639 probably null Het
Rpl12 T C 2: 32,962,524 probably benign Het
Ryr3 T C 2: 113,030,292 probably benign Het
Scarb1 C A 5: 125,340,907 probably benign Het
Sox10 T C 15: 79,156,263 E359G probably damaging Het
Taf5 A G 19: 47,067,789 T9A unknown Het
Tmem128 C T 5: 38,266,541 A33V possibly damaging Het
Tox A C 4: 6,697,444 V453G probably benign Het
Ubxn4 T A 1: 128,256,130 C76S probably damaging Het
Vmn2r100 A T 17: 19,523,524 Y483F probably benign Het
Xkr5 A G 8: 18,940,790 S154P probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Other mutations in Islr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Islr2 APN 9 58199786 missense probably benign 0.03
IGL01444:Islr2 APN 9 58198378 missense probably damaging 1.00
R0346:Islr2 UTSW 9 58198343 nonsense probably null
R0360:Islr2 UTSW 9 58199744 missense possibly damaging 0.82
R0364:Islr2 UTSW 9 58199744 missense possibly damaging 0.82
R0528:Islr2 UTSW 9 58199362 missense probably damaging 0.97
R0693:Islr2 UTSW 9 58199744 missense possibly damaging 0.82
R1854:Islr2 UTSW 9 58199816 missense probably damaging 0.97
R2893:Islr2 UTSW 9 58197866 missense probably damaging 1.00
R3747:Islr2 UTSW 9 58199642 missense probably benign 0.00
R3914:Islr2 UTSW 9 58198383 nonsense probably null
R4176:Islr2 UTSW 9 58199900 missense probably damaging 1.00
R4212:Islr2 UTSW 9 58199320 missense probably damaging 1.00
R4844:Islr2 UTSW 9 58208234 unclassified probably benign
R5303:Islr2 UTSW 9 58208275 unclassified probably benign
R5636:Islr2 UTSW 9 58201301 missense probably benign 0.03
R5787:Islr2 UTSW 9 58198354 missense probably damaging 0.97
R6406:Islr2 UTSW 9 58199980 missense probably benign
R7105:Islr2 UTSW 9 58197814 missense probably damaging 1.00
R7130:Islr2 UTSW 9 58198292 missense probably damaging 1.00
R7316:Islr2 UTSW 9 58197967 missense probably damaging 0.99
X0026:Islr2 UTSW 9 58198286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACGTGCGGCTTGAGATC -3'
(R):5'- GCAGGCATCTACACTTGTCG -3'

Sequencing Primer
(F):5'- CGGCTTGAGATCTGAGCTC -3'
(R):5'- TTGTCGTGCACACAATGAGC -3'
Posted On2017-02-10