Incidental Mutation 'R5883:Larp1'
ID454530
Institutional Source Beutler Lab
Gene Symbol Larp1
Ensembl Gene ENSMUSG00000037331
Gene NameLa ribonucleoprotein domain family, member 1
Synonyms1810024J12Rik, 3110040D16Rik, Larp
MMRRC Submission 044086-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5883 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58009064-58062034 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58042299 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 243 (S243F)
Ref Sequence ENSEMBL: ENSMUSP00000071421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071487] [ENSMUST00000178636]
Predicted Effect probably damaging
Transcript: ENSMUST00000071487
AA Change: S243F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071421
Gene: ENSMUSG00000037331
AA Change: S243F

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 37 87 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 304 331 N/A INTRINSIC
LA 376 452 1.98e-40 SMART
low complexity region 538 555 N/A INTRINSIC
low complexity region 562 571 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
low complexity region 758 766 N/A INTRINSIC
DM15 861 902 7.3e-20 SMART
DM15 903 941 3.85e-19 SMART
DM15 942 977 8.59e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140500
Predicted Effect probably damaging
Transcript: ENSMUST00000178636
AA Change: S243F

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136673
Gene: ENSMUSG00000037331
AA Change: S243F

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 37 87 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
low complexity region 122 136 N/A INTRINSIC
low complexity region 304 331 N/A INTRINSIC
LA 376 452 1.98e-40 SMART
low complexity region 538 555 N/A INTRINSIC
low complexity region 562 571 N/A INTRINSIC
low complexity region 575 589 N/A INTRINSIC
low complexity region 758 766 N/A INTRINSIC
DM15 861 902 7.3e-20 SMART
DM15 903 941 3.85e-19 SMART
DM15 942 977 8.59e-1 SMART
Meta Mutation Damage Score 0.0328 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.9%
  • 20x: 83.7%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,145,641 V103I probably damaging Het
Aass G A 6: 23,072,994 T920I probably benign Het
Akirin2 A G 4: 34,565,256 I168V possibly damaging Het
Ambn T A 5: 88,467,829 Y372* probably null Het
Ano3 T A 2: 110,880,864 E85V probably null Het
Bmf C T 2: 118,546,966 silent Het
Bmper T A 9: 23,406,674 S530T probably benign Het
Bop1 T C 15: 76,454,849 D383G probably damaging Het
Bub1b T A 2: 118,609,882 Y156N probably damaging Het
Cacna1h A G 17: 25,376,922 V1987A probably benign Het
Cd84 T C 1: 171,872,838 V174A possibly damaging Het
Cep290 T A 10: 100,523,399 L997Q probably benign Het
Chil4 C T 3: 106,210,570 R128H possibly damaging Het
Cpne3 A T 4: 19,552,314 V106D possibly damaging Het
D6Wsu163e A G 6: 126,966,916 E425G probably damaging Het
Dlgap1 A T 17: 70,517,013 probably benign Het
Dnhd1 C A 7: 105,720,504 H4379N probably damaging Het
Gm10309 A G 17: 86,498,757 probably benign Het
Gm6264 G A 1: 85,171,182 probably benign Het
Has2 T A 15: 56,668,063 I419F possibly damaging Het
Hscb A G 5: 110,839,578 C51R probably benign Het
Ighv1-61 T C 12: 115,359,563 S4G probably benign Het
Islr2 G T 9: 58,198,715 Q465K probably benign Het
Jakmip2 T C 18: 43,581,994 I156V possibly damaging Het
Klk1b24 A G 7: 44,190,363 I49V probably benign Het
Krt90 C T 15: 101,553,219 probably benign Het
Lrp4 T C 2: 91,488,433 Y872H probably benign Het
Maip1 T C 1: 57,407,101 M110T probably damaging Het
March7 G A 2: 60,234,442 R354Q probably damaging Het
Med12l G T 3: 59,091,468 E605D probably damaging Het
Nt5c1a T A 4: 123,216,256 probably null Het
Olfr209 A T 16: 59,361,715 C168S probably damaging Het
Olfr490 C T 7: 108,286,244 S294N probably damaging Het
Olfr531 T A 7: 140,400,188 Y286F probably damaging Het
Pdzd9 T A 7: 120,668,553 E13V possibly damaging Het
Ppip5k2 C T 1: 97,707,810 A1100T possibly damaging Het
Prkdc C A 16: 15,715,914 Q1539K probably benign Het
Rad54l C G 4: 116,099,046 probably benign Het
Ric1 T A 19: 29,595,989 I943N probably damaging Het
Rif1 T A 2: 52,105,639 probably null Het
Rpl12 T C 2: 32,962,524 probably benign Het
Ryr3 T C 2: 113,030,292 probably benign Het
Scarb1 C A 5: 125,340,907 probably benign Het
Sox10 T C 15: 79,156,263 E359G probably damaging Het
Taf5 A G 19: 47,067,789 T9A unknown Het
Tmem128 C T 5: 38,266,541 A33V possibly damaging Het
Tox A C 4: 6,697,444 V453G probably benign Het
Ubxn4 T A 1: 128,256,130 C76S probably damaging Het
Vmn2r100 A T 17: 19,523,524 Y483F probably benign Het
Xkr5 A G 8: 18,940,790 S154P probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Other mutations in Larp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Larp1 APN 11 58042822 missense possibly damaging 0.91
IGL02114:Larp1 APN 11 58057055 missense probably damaging 1.00
IGL03084:Larp1 APN 11 58057095 missense probably damaging 1.00
IGL03126:Larp1 APN 11 58050877 missense possibly damaging 0.65
IGL03278:Larp1 APN 11 58044056 splice site probably benign
R0009:Larp1 UTSW 11 58055473 missense possibly damaging 0.94
R0020:Larp1 UTSW 11 58050023 missense probably damaging 1.00
R0479:Larp1 UTSW 11 58042820 missense possibly damaging 0.92
R0845:Larp1 UTSW 11 58047750 missense probably benign 0.00
R1691:Larp1 UTSW 11 58048048 missense probably benign 0.08
R1793:Larp1 UTSW 11 58049938 missense possibly damaging 0.60
R3618:Larp1 UTSW 11 58057346 missense probably benign 0.03
R4689:Larp1 UTSW 11 58041613 missense probably damaging 1.00
R4797:Larp1 UTSW 11 58047980 nonsense probably null
R5089:Larp1 UTSW 11 58047867 missense possibly damaging 0.92
R5309:Larp1 UTSW 11 58050808 missense possibly damaging 0.72
R5951:Larp1 UTSW 11 58049939 missense probably benign 0.14
R6038:Larp1 UTSW 11 58041605 missense possibly damaging 0.68
R6038:Larp1 UTSW 11 58041605 missense possibly damaging 0.68
R6266:Larp1 UTSW 11 58042263 missense probably damaging 0.99
R6350:Larp1 UTSW 11 58049831 missense probably benign 0.14
R6650:Larp1 UTSW 11 58058596 frame shift probably null
R6687:Larp1 UTSW 11 58057330 missense probably damaging 0.99
R6736:Larp1 UTSW 11 58042647 splice site probably null
R6881:Larp1 UTSW 11 58050023 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTACACCTAGAACCGCTGG -3'
(R):5'- CAGATACAGGCATGTAGGTGGC -3'

Sequencing Primer
(F):5'- CAATAAAACAGAGGTCTGGTGTTTG -3'
(R):5'- TGGCAGGTTCAGATCCTATAGTAAG -3'
Posted On2017-02-10