Incidental Mutation 'R5883:Krt90'
ID454535
Institutional Source Beutler Lab
Gene Symbol Krt90
Ensembl Gene ENSMUSG00000048699
Gene Namekeratin 90
Synonyms4732456N10Rik
MMRRC Submission 044086-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5883 (G1)
Quality Score205
Status Validated
Chromosome15
Chromosomal Location101552356-101562950 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 101553219 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023713] [ENSMUST00000023714]
Predicted Effect probably benign
Transcript: ENSMUST00000023713
SMART Domains Protein: ENSMUSP00000023713
Gene: ENSMUSG00000049548

DomainStartEndE-ValueType
low complexity region 38 57 N/A INTRINSIC
Pfam:Keratin_2_head 61 114 6.1e-13 PFAM
Filament 117 428 1.32e-153 SMART
Predicted Effect unknown
Transcript: ENSMUST00000023714
AA Change: V516M
SMART Domains Protein: ENSMUSP00000023714
Gene: ENSMUSG00000048699
AA Change: V516M

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 139 3.1e-24 PFAM
Filament 142 453 1.05e-179 SMART
low complexity region 465 522 N/A INTRINSIC
low complexity region 527 535 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197418
Meta Mutation Damage Score 0.0468 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.9%
  • 20x: 83.7%
Validation Efficiency 100% (70/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit partial prenatal lethality and thickened long toenails. An increased caudal vertebrae number is observed in some mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik G A 8: 120,145,641 V103I probably damaging Het
Aass G A 6: 23,072,994 T920I probably benign Het
Akirin2 A G 4: 34,565,256 I168V possibly damaging Het
Ambn T A 5: 88,467,829 Y372* probably null Het
Ano3 T A 2: 110,880,864 E85V probably null Het
Bmf C T 2: 118,546,966 silent Het
Bmper T A 9: 23,406,674 S530T probably benign Het
Bop1 T C 15: 76,454,849 D383G probably damaging Het
Bub1b T A 2: 118,609,882 Y156N probably damaging Het
Cacna1h A G 17: 25,376,922 V1987A probably benign Het
Cd84 T C 1: 171,872,838 V174A possibly damaging Het
Cep290 T A 10: 100,523,399 L997Q probably benign Het
Chil4 C T 3: 106,210,570 R128H possibly damaging Het
Cpne3 A T 4: 19,552,314 V106D possibly damaging Het
D6Wsu163e A G 6: 126,966,916 E425G probably damaging Het
Dlgap1 A T 17: 70,517,013 probably benign Het
Dnhd1 C A 7: 105,720,504 H4379N probably damaging Het
Gm10309 A G 17: 86,498,757 probably benign Het
Gm6264 G A 1: 85,171,182 probably benign Het
Has2 T A 15: 56,668,063 I419F possibly damaging Het
Hscb A G 5: 110,839,578 C51R probably benign Het
Ighv1-61 T C 12: 115,359,563 S4G probably benign Het
Islr2 G T 9: 58,198,715 Q465K probably benign Het
Jakmip2 T C 18: 43,581,994 I156V possibly damaging Het
Klk1b24 A G 7: 44,190,363 I49V probably benign Het
Larp1 C T 11: 58,042,299 S243F probably damaging Het
Lrp4 T C 2: 91,488,433 Y872H probably benign Het
Maip1 T C 1: 57,407,101 M110T probably damaging Het
March7 G A 2: 60,234,442 R354Q probably damaging Het
Med12l G T 3: 59,091,468 E605D probably damaging Het
Nt5c1a T A 4: 123,216,256 probably null Het
Olfr209 A T 16: 59,361,715 C168S probably damaging Het
Olfr490 C T 7: 108,286,244 S294N probably damaging Het
Olfr531 T A 7: 140,400,188 Y286F probably damaging Het
Pdzd9 T A 7: 120,668,553 E13V possibly damaging Het
Ppip5k2 C T 1: 97,707,810 A1100T possibly damaging Het
Prkdc C A 16: 15,715,914 Q1539K probably benign Het
Rad54l C G 4: 116,099,046 probably benign Het
Ric1 T A 19: 29,595,989 I943N probably damaging Het
Rif1 T A 2: 52,105,639 probably null Het
Rpl12 T C 2: 32,962,524 probably benign Het
Ryr3 T C 2: 113,030,292 probably benign Het
Scarb1 C A 5: 125,340,907 probably benign Het
Sox10 T C 15: 79,156,263 E359G probably damaging Het
Taf5 A G 19: 47,067,789 T9A unknown Het
Tmem128 C T 5: 38,266,541 A33V possibly damaging Het
Tox A C 4: 6,697,444 V453G probably benign Het
Ubxn4 T A 1: 128,256,130 C76S probably damaging Het
Vmn2r100 A T 17: 19,523,524 Y483F probably benign Het
Xkr5 A G 8: 18,940,790 S154P probably damaging Het
Zfp687 T C 3: 95,012,044 N139S probably benign Het
Other mutations in Krt90
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0243:Krt90 UTSW 15 101562675 missense possibly damaging 0.78
R0732:Krt90 UTSW 15 101560425 missense possibly damaging 0.60
R1036:Krt90 UTSW 15 101562716 missense probably benign 0.05
R1616:Krt90 UTSW 15 101560591 missense possibly damaging 0.46
R1750:Krt90 UTSW 15 101553365 unclassified probably benign
R1919:Krt90 UTSW 15 101557230 missense probably damaging 1.00
R2063:Krt90 UTSW 15 101558359 missense probably benign 0.07
R2107:Krt90 UTSW 15 101562629 missense probably benign 0.06
R2155:Krt90 UTSW 15 101562611 missense probably benign 0.00
R2404:Krt90 UTSW 15 101554670 critical splice donor site probably null
R3412:Krt90 UTSW 15 101560593 missense probably damaging 1.00
R3910:Krt90 UTSW 15 101562783 missense probably damaging 1.00
R3911:Krt90 UTSW 15 101562783 missense probably damaging 1.00
R3913:Krt90 UTSW 15 101562783 missense probably damaging 1.00
R4476:Krt90 UTSW 15 101557283 missense probably damaging 1.00
R4748:Krt90 UTSW 15 101555333 missense probably damaging 1.00
R4918:Krt90 UTSW 15 101562479 missense possibly damaging 0.47
R6416:Krt90 UTSW 15 101559244 missense probably benign 0.12
R6674:Krt90 UTSW 15 101557326 missense probably damaging 0.99
R7025:Krt90 UTSW 15 101557175 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCAAGAATGGGTGGGGTATCTC -3'
(R):5'- GCCAATGACAGCTGTTCCTTC -3'

Sequencing Primer
(F):5'- AACTCACAGGCCACTTGGTATCTG -3'
(R):5'- ATGACAGCTGTTCCTTCTTCTTTCAG -3'
Posted On2017-02-10