Incidental Mutation 'R5884:Dtx3l'
ID454592
Institutional Source Beutler Lab
Gene Symbol Dtx3l
Ensembl Gene ENSMUSG00000049502
Gene Namedeltex 3-like, E3 ubiquitin ligase
Synonyms
MMRRC Submission 044087-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R5884 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location35926511-35939151 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 35932233 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 668 (E668Q)
Ref Sequence ENSEMBL: ENSMUSP00000110535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081933] [ENSMUST00000114885]
Predicted Effect probably benign
Transcript: ENSMUST00000081933
SMART Domains Protein: ENSMUSP00000080601
Gene: ENSMUSG00000049502

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
RING 569 607 5.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114885
AA Change: E668Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110535
Gene: ENSMUSG00000049502
AA Change: E668Q

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
RING 569 607 5.82e-6 SMART
Meta Mutation Damage Score 0.1212 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 95.6%
  • 20x: 82.8%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DTX3L functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bmp5 T C 9: 75,898,554 M446T probably damaging Het
Cacna1g C T 11: 94,437,867 A1052T probably damaging Het
Cand1 C T 10: 119,213,765 A359T possibly damaging Het
Ccne2 A T 4: 11,199,411 T271S probably benign Het
Cep112 A G 11: 108,570,316 T546A probably damaging Het
Ces1g A G 8: 93,306,930 S455P probably benign Het
Dnah11 A T 12: 118,177,534 C496S probably benign Het
Dysf T A 6: 84,186,081 F1579I probably damaging Het
Emx2 T G 19: 59,464,029 D248E probably damaging Het
Eri2 A C 7: 119,772,329 *275E probably null Het
F5 G A 1: 164,195,646 R1591H probably benign Het
Fabp3 A G 4: 130,312,338 T41A probably benign Het
Fam89a C T 8: 124,751,769 R14H probably damaging Het
Gbe1 T A 16: 70,528,875 probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Golga3 A G 5: 110,216,895 E1211G probably damaging Het
Gpa33 T C 1: 166,152,760 S131P probably damaging Het
Hyal6 T C 6: 24,743,369 Y355H probably damaging Het
Ide A T 19: 37,272,153 probably null Het
Ighv5-21 A T 12: 114,320,186 probably benign Het
Iglc1 A T 16: 19,061,991 probably benign Het
Impa1 A T 3: 10,316,224 N199K probably damaging Het
Irx5 A C 8: 92,360,630 T397P possibly damaging Het
Kdelc1 T C 1: 44,117,100 N109S probably benign Het
Lonp2 A G 8: 86,641,626 Y356C probably damaging Het
Matn4 A T 2: 164,404,608 probably benign Het
Nav2 T A 7: 49,597,169 Y2147* probably null Het
Nek5 C T 8: 22,088,801 probably null Het
Olfr1014 T A 2: 85,777,055 I157K probably damaging Het
Olfr1164 A G 2: 88,093,796 Y47H probably damaging Het
Olfr1348 C A 7: 6,501,843 V128L probably benign Het
Omt2b A G 9: 78,328,557 M55V probably benign Het
Parp4 T A 14: 56,614,750 H796Q probably damaging Het
Pex2 T C 3: 5,561,299 E150G probably benign Het
Psmb2 T A 4: 126,684,221 V64E possibly damaging Het
Psmd6 C T 14: 14,116,526 R63H probably damaging Het
Ptprd A G 4: 75,982,690 Y1061H probably damaging Het
Rab23 A G 1: 33,724,886 probably benign Het
Rad51ap2 GAAAAGGAAACTATTTAAAA GAAAA 12: 11,457,533 probably benign Het
Reg1 C T 6: 78,428,217 S141L possibly damaging Het
Rock1 A T 18: 10,099,361 I680K probably benign Het
Sez6l2 A G 7: 126,970,156 probably benign Het
Slc34a2 A T 5: 53,069,380 Q615L possibly damaging Het
Slu7 A G 11: 43,443,418 K424E probably benign Het
Tctn2 A T 5: 124,603,832 noncoding transcript Het
Tmem87a T A 2: 120,404,124 probably benign Het
Trappc4 A G 9: 44,404,088 F198L probably damaging Het
Usp33 C T 3: 152,368,330 T271I probably benign Het
Vmn1r15 T A 6: 57,259,008 I287K probably damaging Het
Vmn2r75 A C 7: 86,165,370 I305R probably benign Het
Wdr26 T C 1: 181,187,541 probably benign Het
Zzz3 T C 3: 152,450,658 S684P probably damaging Het
Other mutations in Dtx3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01814:Dtx3l APN 16 35931502 missense probably benign 0.10
IGL02255:Dtx3l APN 16 35933336 missense probably benign 0.10
R0560:Dtx3l UTSW 16 35932935 missense probably damaging 1.00
R1123:Dtx3l UTSW 16 35933268 missense probably damaging 1.00
R1127:Dtx3l UTSW 16 35938757 missense possibly damaging 0.74
R1466:Dtx3l UTSW 16 35932728 missense probably damaging 1.00
R1466:Dtx3l UTSW 16 35932728 missense probably damaging 1.00
R1584:Dtx3l UTSW 16 35932728 missense probably damaging 1.00
R1690:Dtx3l UTSW 16 35933268 missense probably damaging 1.00
R1929:Dtx3l UTSW 16 35933689 missense possibly damaging 0.95
R2014:Dtx3l UTSW 16 35936427 missense probably benign 0.08
R2015:Dtx3l UTSW 16 35936427 missense probably benign 0.08
R2255:Dtx3l UTSW 16 35936579 missense probably benign 0.01
R3023:Dtx3l UTSW 16 35932436 missense probably benign 0.01
R3176:Dtx3l UTSW 16 35932173 missense probably benign 0.29
R5224:Dtx3l UTSW 16 35938793 missense possibly damaging 0.93
R5233:Dtx3l UTSW 16 35933238 missense possibly damaging 0.49
R5375:Dtx3l UTSW 16 35933027 missense probably damaging 1.00
R6821:Dtx3l UTSW 16 35933060 missense probably damaging 1.00
R6994:Dtx3l UTSW 16 35931372 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTTCAAATTAGAACACTACCTGCC -3'
(R):5'- TCCTACGGCATCCAGAAAGG -3'

Sequencing Primer
(F):5'- ATTGAGTTCCAGGACAGCC -3'
(R):5'- GGAACCAGCCAGAGGGAAC -3'
Posted On2017-02-10