Incidental Mutation 'R5850:Smyd3'
ID454603
Institutional Source Beutler Lab
Gene Symbol Smyd3
Ensembl Gene ENSMUSG00000055067
Gene NameSET and MYND domain containing 3
Synonyms2410008A19Rik, Zmynd1
MMRRC Submission 043226-MU
Accession Numbers

Genbank: NM_027188; MGI: 1916976; Ensembl: ENSMUST00000128302, ENSMUST00000111134, ENSMUST00000111133

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5850 (G1)
Quality Score199
Status Not validated
Chromosome1
Chromosomal Location178951960-179518041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 179043855 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 320 (L320F)
Ref Sequence ENSEMBL: ENSMUSP00000117410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128302]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000068437
Predicted Effect probably damaging
Transcript: ENSMUST00000128302
AA Change: L320F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117410
Gene: ENSMUSG00000055067
AA Change: L320F

DomainStartEndE-ValueType
SET 4 246 1.04e-11 SMART
low complexity region 410 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131684
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone methyltransferase which functions in RNA polymerase II complexes by an interaction with a specific RNA helicase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Targeted, other(5) Gene trapped(29)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Abhd14a A C 9: 106,440,349 L225R probably damaging Het
Apbb1 A G 7: 105,567,583 S39P probably damaging Het
Apc T C 18: 34,318,063 S2637P possibly damaging Het
Apold1 T C 6: 134,984,095 F171L probably damaging Het
Ascc3 T C 10: 50,710,953 M967T probably damaging Het
Atf7ip T C 6: 136,566,787 probably null Het
Bcl2l15 T A 3: 103,836,116 V111D possibly damaging Het
Bsn A T 9: 108,114,950 M1201K probably damaging Het
Ccdc141 T A 2: 77,029,403 N965Y probably damaging Het
Cnn3 T C 3: 121,451,928 Y98H probably damaging Het
Cnot1 G A 8: 95,734,147 R117* probably null Het
Dlgap1 G A 17: 70,787,092 V803M probably damaging Het
Drd3 A C 16: 43,818,332 M299L probably benign Het
Ergic2 C A 6: 148,183,107 M34I possibly damaging Het
Ext2 A T 2: 93,813,659 D92E possibly damaging Het
Fmnl1 A G 11: 103,195,285 probably benign Het
Ganab C T 19: 8,911,707 R591W probably damaging Het
Kdsr A T 1: 106,755,442 probably null Het
Macf1 T C 4: 123,507,306 E813G probably damaging Het
Nlrc5 A G 8: 94,521,047 T1621A probably benign Het
Nmnat1 G A 4: 149,469,667 Q139* probably null Het
Os9 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 10: 127,098,479 probably benign Het
Oxa1l T G 14: 54,367,664 V11G possibly damaging Het
Padi1 A G 4: 140,814,830 Y594H probably benign Het
Polr1a T A 6: 71,926,683 F327I probably benign Het
Prf1 G T 10: 61,300,193 A83S probably benign Het
Ptgs2 A G 1: 150,105,376 E470G probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc19a2 A G 1: 164,263,456 I278V probably benign Het
Smco1 A T 16: 32,273,856 N115I probably damaging Het
Svil T A 18: 5,098,900 probably null Het
Syne2 A G 12: 76,097,975 D1566G probably damaging Het
Tpm2 T C 4: 43,523,296 D20G probably damaging Het
Ubap1l A G 9: 65,373,763 Y241C probably damaging Het
Usp15 A G 10: 123,124,512 probably null Het
Wdr45b A G 11: 121,331,097 probably benign Het
Zc3h14 A G 12: 98,779,155 I468V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Smyd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02044:Smyd3 APN 1 178972279 missense probably benign
IGL03088:Smyd3 APN 1 179094333 critical splice donor site probably null
D3080:Smyd3 UTSW 1 179086422 missense probably damaging 1.00
R0165:Smyd3 UTSW 1 179043872 missense probably benign
R0230:Smyd3 UTSW 1 179423428 splice site probably benign
R0390:Smyd3 UTSW 1 178957573 splice site probably benign
R1651:Smyd3 UTSW 1 179043876 missense probably benign
R4651:Smyd3 UTSW 1 179043741 missense probably benign 0.08
R4771:Smyd3 UTSW 1 179094396 missense probably damaging 0.99
R5326:Smyd3 UTSW 1 179410459 missense probably benign
R5542:Smyd3 UTSW 1 179410459 missense probably benign
R5697:Smyd3 UTSW 1 179411682 missense probably damaging 1.00
R6732:Smyd3 UTSW 1 179395830 missense probably benign 0.01
X0024:Smyd3 UTSW 1 179050289 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATATCAGTCAGAACAGCGGCC -3'
(R):5'- AGTACGTTTTCCAGGCTGC -3'

Sequencing Primer
(F):5'- CATCCCAAGCCCACAGTGG -3'
(R):5'- CCCTTCTGTGCAAAATAATGGGAGC -3'
Posted On2017-02-10