Incidental Mutation 'R5850:Tpm2'
ID454609
Institutional Source Beutler Lab
Gene Symbol Tpm2
Ensembl Gene ENSMUSG00000028464
Gene Nametropomyosin 2, beta
SynonymsTrop-2, Tpm-2
MMRRC Submission 043226-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.553) question?
Stock #R5850 (G1)
Quality Score197
Status Not validated
Chromosome4
Chromosomal Location43514711-43523765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43523296 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 20 (D20G)
Ref Sequence ENSEMBL: ENSMUSP00000030184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030184] [ENSMUST00000107913] [ENSMUST00000107914] [ENSMUST00000150592]
Predicted Effect probably damaging
Transcript: ENSMUST00000030184
AA Change: D20G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030184
Gene: ENSMUSG00000028464
AA Change: D20G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 3.3e-39 PFAM
Pfam:Tropomyosin 48 284 1.5e-97 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107913
AA Change: D20G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103546
Gene: ENSMUSG00000028464
AA Change: D20G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 6.5e-36 PFAM
Pfam:Tropomyosin 48 284 4.8e-98 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107914
AA Change: D20G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103547
Gene: ENSMUSG00000028464
AA Change: D20G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 7.2e-39 PFAM
Pfam:Tropomyosin 48 284 6.3e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150262
Predicted Effect possibly damaging
Transcript: ENSMUST00000150592
AA Change: D20G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119908
Gene: ENSMUSG00000028464
AA Change: D20G

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 106 2.2e-26 PFAM
Pfam:Tropomyosin 48 106 1.1e-18 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the tropomyosin family which encodes proteins that bind to actin filaments and stabilize them by regulating access to actin modifying proteins. The encoded protein is a high molecular weight tropomyosin expressed in slow skeletal muscle. In humans, mutations in this gene are associated with nemaline myopathy, cap disease and distal arthrogryposis syndromes. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2013]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Abhd14a A C 9: 106,440,349 L225R probably damaging Het
Apbb1 A G 7: 105,567,583 S39P probably damaging Het
Apc T C 18: 34,318,063 S2637P possibly damaging Het
Apold1 T C 6: 134,984,095 F171L probably damaging Het
Ascc3 T C 10: 50,710,953 M967T probably damaging Het
Atf7ip T C 6: 136,566,787 probably null Het
Bcl2l15 T A 3: 103,836,116 V111D possibly damaging Het
Bsn A T 9: 108,114,950 M1201K probably damaging Het
Ccdc141 T A 2: 77,029,403 N965Y probably damaging Het
Cnn3 T C 3: 121,451,928 Y98H probably damaging Het
Cnot1 G A 8: 95,734,147 R117* probably null Het
Dlgap1 G A 17: 70,787,092 V803M probably damaging Het
Drd3 A C 16: 43,818,332 M299L probably benign Het
Ergic2 C A 6: 148,183,107 M34I possibly damaging Het
Ext2 A T 2: 93,813,659 D92E possibly damaging Het
Fmnl1 A G 11: 103,195,285 probably benign Het
Ganab C T 19: 8,911,707 R591W probably damaging Het
Kdsr A T 1: 106,755,442 probably null Het
Macf1 T C 4: 123,507,306 E813G probably damaging Het
Nlrc5 A G 8: 94,521,047 T1621A probably benign Het
Nmnat1 G A 4: 149,469,667 Q139* probably null Het
Os9 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 10: 127,098,479 probably benign Het
Oxa1l T G 14: 54,367,664 V11G possibly damaging Het
Padi1 A G 4: 140,814,830 Y594H probably benign Het
Polr1a T A 6: 71,926,683 F327I probably benign Het
Prf1 G T 10: 61,300,193 A83S probably benign Het
Ptgs2 A G 1: 150,105,376 E470G probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc19a2 A G 1: 164,263,456 I278V probably benign Het
Smco1 A T 16: 32,273,856 N115I probably damaging Het
Smyd3 G A 1: 179,043,855 L320F probably damaging Het
Svil T A 18: 5,098,900 probably null Het
Syne2 A G 12: 76,097,975 D1566G probably damaging Het
Ubap1l A G 9: 65,373,763 Y241C probably damaging Het
Usp15 A G 10: 123,124,512 probably null Het
Wdr45b A G 11: 121,331,097 probably benign Het
Zc3h14 A G 12: 98,779,155 I468V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Tpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Tpm2 APN 4 43518251 missense probably damaging 1.00
IGL01447:Tpm2 APN 4 43518251 nonsense probably null
IGL03145:Tpm2 APN 4 43519447 missense probably damaging 0.97
PIT4791001:Tpm2 UTSW 4 43519263 missense probably benign 0.30
R0970:Tpm2 UTSW 4 43515968 missense probably benign 0.02
R2427:Tpm2 UTSW 4 43523306 missense probably damaging 1.00
R4835:Tpm2 UTSW 4 43519220 unclassified probably null
R5249:Tpm2 UTSW 4 43514828 missense probably benign
R5519:Tpm2 UTSW 4 43522751 missense possibly damaging 0.87
R5568:Tpm2 UTSW 4 43522692 nonsense probably null
R5746:Tpm2 UTSW 4 43519731 missense possibly damaging 0.90
R5810:Tpm2 UTSW 4 43518968 unclassified probably benign
R6000:Tpm2 UTSW 4 43518301 critical splice acceptor site probably null
R6820:Tpm2 UTSW 4 43518443 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTGTAATGACTGGAGTGGTAAC -3'
(R):5'- GACATCACAGTCCCTCTTGGTC -3'

Sequencing Primer
(F):5'- AGTGGTAACTGGGCACTCTC -3'
(R):5'- AGTCCCTCTTGGTCCTCCTGAC -3'
Posted On2017-02-10