Incidental Mutation 'R5850:Padi1'
ID454613
Institutional Source Beutler Lab
Gene Symbol Padi1
Ensembl Gene ENSMUSG00000025329
Gene Namepeptidyl arginine deiminase, type I
SynonymsPad type 1, Pdi1
MMRRC Submission 043226-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R5850 (G1)
Quality Score185
Status Not validated
Chromosome4
Chromosomal Location140812983-140845778 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140814830 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 594 (Y594H)
Ref Sequence ENSEMBL: ENSMUSP00000026378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026377] [ENSMUST00000026378]
Predicted Effect probably benign
Transcript: ENSMUST00000026377
SMART Domains Protein: ENSMUSP00000026377
Gene: ENSMUSG00000025328

DomainStartEndE-ValueType
Pfam:PAD_N 1 113 2.1e-38 PFAM
Pfam:PAD_M 115 273 4.2e-61 PFAM
Pfam:PAD 283 661 2.3e-169 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026378
AA Change: Y594H

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000026378
Gene: ENSMUSG00000025329
AA Change: Y594H

DomainStartEndE-ValueType
Pfam:PAD_N 1 113 5.4e-39 PFAM
Pfam:PAD_M 115 272 1.3e-63 PFAM
Pfam:PAD 280 659 9.4e-170 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151848
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type I enzyme is involved in the late stages of epidermal differentiation, where it deiminates filaggrin and keratin K1, which maintains hydration of the stratum corneum, and hence the cutaneous barrier function. This enzyme may also play a role in hair follicle formation. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Abhd14a A C 9: 106,440,349 L225R probably damaging Het
Apbb1 A G 7: 105,567,583 S39P probably damaging Het
Apc T C 18: 34,318,063 S2637P possibly damaging Het
Apold1 T C 6: 134,984,095 F171L probably damaging Het
Ascc3 T C 10: 50,710,953 M967T probably damaging Het
Atf7ip T C 6: 136,566,787 probably null Het
Bcl2l15 T A 3: 103,836,116 V111D possibly damaging Het
Bsn A T 9: 108,114,950 M1201K probably damaging Het
Ccdc141 T A 2: 77,029,403 N965Y probably damaging Het
Cnn3 T C 3: 121,451,928 Y98H probably damaging Het
Cnot1 G A 8: 95,734,147 R117* probably null Het
Dlgap1 G A 17: 70,787,092 V803M probably damaging Het
Drd3 A C 16: 43,818,332 M299L probably benign Het
Ergic2 C A 6: 148,183,107 M34I possibly damaging Het
Ext2 A T 2: 93,813,659 D92E possibly damaging Het
Fmnl1 A G 11: 103,195,285 probably benign Het
Ganab C T 19: 8,911,707 R591W probably damaging Het
Kdsr A T 1: 106,755,442 probably null Het
Macf1 T C 4: 123,507,306 E813G probably damaging Het
Nlrc5 A G 8: 94,521,047 T1621A probably benign Het
Nmnat1 G A 4: 149,469,667 Q139* probably null Het
Os9 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 10: 127,098,479 probably benign Het
Oxa1l T G 14: 54,367,664 V11G possibly damaging Het
Polr1a T A 6: 71,926,683 F327I probably benign Het
Prf1 G T 10: 61,300,193 A83S probably benign Het
Ptgs2 A G 1: 150,105,376 E470G probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc19a2 A G 1: 164,263,456 I278V probably benign Het
Smco1 A T 16: 32,273,856 N115I probably damaging Het
Smyd3 G A 1: 179,043,855 L320F probably damaging Het
Svil T A 18: 5,098,900 probably null Het
Syne2 A G 12: 76,097,975 D1566G probably damaging Het
Tpm2 T C 4: 43,523,296 D20G probably damaging Het
Ubap1l A G 9: 65,373,763 Y241C probably damaging Het
Usp15 A G 10: 123,124,512 probably null Het
Wdr45b A G 11: 121,331,097 probably benign Het
Zc3h14 A G 12: 98,779,155 I468V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Padi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01844:Padi1 APN 4 140829435 missense probably damaging 1.00
IGL01972:Padi1 APN 4 140818859 splice site probably benign
IGL03260:Padi1 APN 4 140828194 missense probably benign 0.11
R0598:Padi1 UTSW 4 140814787 missense possibly damaging 0.84
R1164:Padi1 UTSW 4 140832329 missense possibly damaging 0.50
R1793:Padi1 UTSW 4 140814656 missense probably damaging 1.00
R4208:Padi1 UTSW 4 140817227 missense possibly damaging 0.80
R4256:Padi1 UTSW 4 140814778 missense probably damaging 1.00
R4484:Padi1 UTSW 4 140817270 intron probably benign
R4926:Padi1 UTSW 4 140824847 missense probably damaging 0.99
R4967:Padi1 UTSW 4 140845590 missense probably benign 0.00
R5066:Padi1 UTSW 4 140829437 missense probably damaging 1.00
R5523:Padi1 UTSW 4 140814853 missense probably damaging 1.00
R5622:Padi1 UTSW 4 140824955 missense probably damaging 1.00
R5870:Padi1 UTSW 4 140826581 missense probably benign 0.39
R5951:Padi1 UTSW 4 140814829 missense probably damaging 1.00
R6187:Padi1 UTSW 4 140826965 missense probably damaging 1.00
R7257:Padi1 UTSW 4 140829471 missense probably damaging 1.00
R7326:Padi1 UTSW 4 140832404 missense probably benign 0.15
R7339:Padi1 UTSW 4 140829234 missense probably null 0.98
X0024:Padi1 UTSW 4 140828167 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAAAAGGTTTCCTCCGCACG -3'
(R):5'- AACATTGTACCACTGAGCTACC -3'

Sequencing Primer
(F):5'- ACGTTGGTGCCACAGTG -3'
(R):5'- CGACTCCCAATTTATAATGGGC -3'
Posted On2017-02-10