Incidental Mutation 'R5850:Prf1'
ID454629
Institutional Source Beutler Lab
Gene Symbol Prf1
Ensembl Gene ENSMUSG00000037202
Gene Nameperforin 1 (pore forming protein)
SynonymsPfn, Prf-1, perforin, Pfp
MMRRC Submission 043226-MU
Accession Numbers

Ncbi RefSeq: NM_011073; MGI: 97551

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5850 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location61297833-61304680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 61300193 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 83 (A83S)
Ref Sequence ENSEMBL: ENSMUSP00000151354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035419] [ENSMUST00000219375]
Predicted Effect probably benign
Transcript: ENSMUST00000035419
AA Change: A83S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000041483
Gene: ENSMUSG00000037202
AA Change: A83S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MACPF 165 368 1.84e-80 SMART
C2 415 516 1.59e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219375
AA Change: A83S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has structural and functional similarities to complement component 9 (C9). Like C9, this protein creates transmembrane tubules and is capable of lysing non-specifically a variety of target cells. This protein is one of the main cytolytic proteins of cytolytic granules, and it is known to be a key effector molecule for T-cell- and natural killer-cell-mediated cytolysis. Defects in this gene cause familial hemophagocytic lymphohistiocytosis type 2 (HPLH2), a rare and lethal autosomal recessive disorder of early childhood. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit increased susceptibility to viral infection and defective cytotoxic T cell cytolysis and NK cell cytolysis. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Abhd14a A C 9: 106,440,349 L225R probably damaging Het
Apbb1 A G 7: 105,567,583 S39P probably damaging Het
Apc T C 18: 34,318,063 S2637P possibly damaging Het
Apold1 T C 6: 134,984,095 F171L probably damaging Het
Ascc3 T C 10: 50,710,953 M967T probably damaging Het
Atf7ip T C 6: 136,566,787 probably null Het
Bcl2l15 T A 3: 103,836,116 V111D possibly damaging Het
Bsn A T 9: 108,114,950 M1201K probably damaging Het
Ccdc141 T A 2: 77,029,403 N965Y probably damaging Het
Cnn3 T C 3: 121,451,928 Y98H probably damaging Het
Cnot1 G A 8: 95,734,147 R117* probably null Het
Dlgap1 G A 17: 70,787,092 V803M probably damaging Het
Drd3 A C 16: 43,818,332 M299L probably benign Het
Ergic2 C A 6: 148,183,107 M34I possibly damaging Het
Ext2 A T 2: 93,813,659 D92E possibly damaging Het
Fmnl1 A G 11: 103,195,285 probably benign Het
Ganab C T 19: 8,911,707 R591W probably damaging Het
Kdsr A T 1: 106,755,442 probably null Het
Macf1 T C 4: 123,507,306 E813G probably damaging Het
Nlrc5 A G 8: 94,521,047 T1621A probably benign Het
Nmnat1 G A 4: 149,469,667 Q139* probably null Het
Os9 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 10: 127,098,479 probably benign Het
Oxa1l T G 14: 54,367,664 V11G possibly damaging Het
Padi1 A G 4: 140,814,830 Y594H probably benign Het
Polr1a T A 6: 71,926,683 F327I probably benign Het
Ptgs2 A G 1: 150,105,376 E470G probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc19a2 A G 1: 164,263,456 I278V probably benign Het
Smco1 A T 16: 32,273,856 N115I probably damaging Het
Smyd3 G A 1: 179,043,855 L320F probably damaging Het
Svil T A 18: 5,098,900 probably null Het
Syne2 A G 12: 76,097,975 D1566G probably damaging Het
Tpm2 T C 4: 43,523,296 D20G probably damaging Het
Ubap1l A G 9: 65,373,763 Y241C probably damaging Het
Usp15 A G 10: 123,124,512 probably null Het
Wdr45b A G 11: 121,331,097 probably benign Het
Zc3h14 A G 12: 98,779,155 I468V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Prf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02970:Prf1 APN 10 61300178 missense probably benign
prime UTSW 10 61303722 nonsense probably null
PIT4802001:Prf1 UTSW 10 61300193 missense probably benign 0.01
R0526:Prf1 UTSW 10 61300254 missense probably benign 0.01
R0594:Prf1 UTSW 10 61303722 nonsense probably null
R1237:Prf1 UTSW 10 61303649 missense probably benign 0.00
R1508:Prf1 UTSW 10 61303550 missense probably damaging 1.00
R1553:Prf1 UTSW 10 61303169 missense probably damaging 1.00
R1665:Prf1 UTSW 10 61302887 missense probably benign 0.29
R1716:Prf1 UTSW 10 61300452 missense probably benign 0.01
R1817:Prf1 UTSW 10 61302983 missense probably damaging 1.00
R1818:Prf1 UTSW 10 61302983 missense probably damaging 1.00
R2014:Prf1 UTSW 10 61303895 missense probably benign 0.41
R2307:Prf1 UTSW 10 61303163 missense possibly damaging 0.80
R2901:Prf1 UTSW 10 61300319 missense probably damaging 0.96
R2902:Prf1 UTSW 10 61300319 missense probably damaging 0.96
R4724:Prf1 UTSW 10 61303708 missense probably damaging 1.00
R4781:Prf1 UTSW 10 61300424 missense probably damaging 1.00
R5327:Prf1 UTSW 10 61300258 missense probably benign 0.00
R5999:Prf1 UTSW 10 61303028 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCGGTCAGAATGCAAGCAG -3'
(R):5'- TCAGCTGCAAAATTGGCTACC -3'

Sequencing Primer
(F):5'- TGCAAGCAGAAGCACAAGTTC -3'
(R):5'- CTGCAAAATTGGCTACCTTGGAG -3'
Posted On2017-02-10