Incidental Mutation 'R5850:Os9'
ID454632
Institutional Source Beutler Lab
Gene Symbol Os9
Ensembl Gene ENSMUSG00000040462
Gene Nameamplified in osteosarcoma
Synonyms4632413K17Rik
MMRRC Submission 043226-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5850 (G1)
Quality Score102
Status Not validated
Chromosome10
Chromosomal Location127095650-127121131 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) TTCCTCCTCCTCCTCCTCCTC to TTCCTCCTCCTCCTCCTC at 127098479 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080975] [ENSMUST00000164259] [ENSMUST00000218798]
Predicted Effect probably benign
Transcript: ENSMUST00000080975
SMART Domains Protein: ENSMUSP00000079770
Gene: ENSMUSG00000040462

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
Pfam:PRKCSH 108 181 2.3e-19 PFAM
low complexity region 317 331 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 518 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164259
SMART Domains Protein: ENSMUSP00000128914
Gene: ENSMUSG00000040462

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
Pfam:PRKCSH 108 181 8.6e-19 PFAM
low complexity region 317 331 N/A INTRINSIC
low complexity region 337 346 N/A INTRINSIC
coiled coil region 418 449 N/A INTRINSIC
low complexity region 518 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218798
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly expressed in osteosarcomas. This protein binds to the hypoxia-inducible factor 1 (HIF-1), a key regulator of the hypoxic response and angiogenesis, and promotes the degradation of one of its subunits. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Abhd14a A C 9: 106,440,349 L225R probably damaging Het
Apbb1 A G 7: 105,567,583 S39P probably damaging Het
Apc T C 18: 34,318,063 S2637P possibly damaging Het
Apold1 T C 6: 134,984,095 F171L probably damaging Het
Ascc3 T C 10: 50,710,953 M967T probably damaging Het
Atf7ip T C 6: 136,566,787 probably null Het
Bcl2l15 T A 3: 103,836,116 V111D possibly damaging Het
Bsn A T 9: 108,114,950 M1201K probably damaging Het
Ccdc141 T A 2: 77,029,403 N965Y probably damaging Het
Cnn3 T C 3: 121,451,928 Y98H probably damaging Het
Cnot1 G A 8: 95,734,147 R117* probably null Het
Dlgap1 G A 17: 70,787,092 V803M probably damaging Het
Drd3 A C 16: 43,818,332 M299L probably benign Het
Ergic2 C A 6: 148,183,107 M34I possibly damaging Het
Ext2 A T 2: 93,813,659 D92E possibly damaging Het
Fmnl1 A G 11: 103,195,285 probably benign Het
Ganab C T 19: 8,911,707 R591W probably damaging Het
Kdsr A T 1: 106,755,442 probably null Het
Macf1 T C 4: 123,507,306 E813G probably damaging Het
Nlrc5 A G 8: 94,521,047 T1621A probably benign Het
Nmnat1 G A 4: 149,469,667 Q139* probably null Het
Oxa1l T G 14: 54,367,664 V11G possibly damaging Het
Padi1 A G 4: 140,814,830 Y594H probably benign Het
Polr1a T A 6: 71,926,683 F327I probably benign Het
Prf1 G T 10: 61,300,193 A83S probably benign Het
Ptgs2 A G 1: 150,105,376 E470G probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc19a2 A G 1: 164,263,456 I278V probably benign Het
Smco1 A T 16: 32,273,856 N115I probably damaging Het
Smyd3 G A 1: 179,043,855 L320F probably damaging Het
Svil T A 18: 5,098,900 probably null Het
Syne2 A G 12: 76,097,975 D1566G probably damaging Het
Tpm2 T C 4: 43,523,296 D20G probably damaging Het
Ubap1l A G 9: 65,373,763 Y241C probably damaging Het
Usp15 A G 10: 123,124,512 probably null Het
Wdr45b A G 11: 121,331,097 probably benign Het
Zc3h14 A G 12: 98,779,155 I468V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Os9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Os9 APN 10 127097976 missense probably benign
IGL00978:Os9 APN 10 127120509 missense probably damaging 1.00
IGL01683:Os9 APN 10 127100103 missense probably damaging 1.00
IGL01862:Os9 APN 10 127099704 missense probably benign 0.00
IGL01997:Os9 APN 10 127119443 missense probably benign 0.00
IGL02035:Os9 APN 10 127096291 missense possibly damaging 0.60
IGL02039:Os9 APN 10 127096291 missense possibly damaging 0.60
IGL02134:Os9 APN 10 127120992 missense possibly damaging 0.91
IGL02851:Os9 APN 10 127099393 intron probably benign
IGL03169:Os9 APN 10 127098594 missense probably benign 0.08
R0211:Os9 UTSW 10 127121036 missense probably damaging 0.97
R0514:Os9 UTSW 10 127119639 missense probably damaging 1.00
R0619:Os9 UTSW 10 127120991 missense probably damaging 1.00
R0930:Os9 UTSW 10 127097055 missense probably damaging 1.00
R1532:Os9 UTSW 10 127098902 missense probably damaging 1.00
R2364:Os9 UTSW 10 127119138 missense possibly damaging 0.90
R4600:Os9 UTSW 10 127098354 missense probably benign 0.06
R4982:Os9 UTSW 10 127121051 missense possibly damaging 0.92
R6148:Os9 UTSW 10 127099943 missense probably benign 0.05
R6257:Os9 UTSW 10 127119137 missense probably damaging 1.00
R6650:Os9 UTSW 10 127100084 critical splice donor site probably null
R6731:Os9 UTSW 10 127098543 missense probably benign
R7090:Os9 UTSW 10 127099678 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATTAATAACTCTCCCGTCGGGTG -3'
(R):5'- CGGACTCCTTCAAACTGCATC -3'

Sequencing Primer
(F):5'- TGGATGATGTTCTCCAGC -3'
(R):5'- GGACTCCTTCAAACTGCATCTTCTAC -3'
Posted On2017-02-10