Incidental Mutation 'R5850:Ganab'
ID454644
Institutional Source Beutler Lab
Gene Symbol Ganab
Ensembl Gene ENSMUSG00000071650
Gene Namealpha glucosidase 2 alpha neutral subunit
SynonymsG2an, GluII
MMRRC Submission 043226-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.870) question?
Stock #R5850 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8898090-8916663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8911707 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 591 (R591W)
Ref Sequence ENSEMBL: ENSMUSP00000093965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096246]
Predicted Effect probably damaging
Transcript: ENSMUST00000096246
AA Change: R591W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093965
Gene: ENSMUSG00000071650
AA Change: R591W

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 157 169 N/A INTRINSIC
Pfam:Gal_mutarotas_2 275 346 3.9e-24 PFAM
Pfam:Glyco_hydro_31 387 832 8.7e-136 PFAM
low complexity region 888 898 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of glucosidase II and a member of the glycosyl hydrolase 31 family of proteins. The heterodimeric enzyme glucosidase II plays a role in protein folding and quality control by cleaving glucose residues from immature glycoproteins in the endoplasmic reticulum. Expression of the encoded protein is elevated in lung tumor tissue and in response to UV irradiation. Mutations in this gene cause autosomal-dominant polycystic kidney and liver disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Abhd14a A C 9: 106,440,349 L225R probably damaging Het
Apbb1 A G 7: 105,567,583 S39P probably damaging Het
Apc T C 18: 34,318,063 S2637P possibly damaging Het
Apold1 T C 6: 134,984,095 F171L probably damaging Het
Ascc3 T C 10: 50,710,953 M967T probably damaging Het
Atf7ip T C 6: 136,566,787 probably null Het
Bcl2l15 T A 3: 103,836,116 V111D possibly damaging Het
Bsn A T 9: 108,114,950 M1201K probably damaging Het
Ccdc141 T A 2: 77,029,403 N965Y probably damaging Het
Cnn3 T C 3: 121,451,928 Y98H probably damaging Het
Cnot1 G A 8: 95,734,147 R117* probably null Het
Dlgap1 G A 17: 70,787,092 V803M probably damaging Het
Drd3 A C 16: 43,818,332 M299L probably benign Het
Ergic2 C A 6: 148,183,107 M34I possibly damaging Het
Ext2 A T 2: 93,813,659 D92E possibly damaging Het
Fmnl1 A G 11: 103,195,285 probably benign Het
Kdsr A T 1: 106,755,442 probably null Het
Macf1 T C 4: 123,507,306 E813G probably damaging Het
Nlrc5 A G 8: 94,521,047 T1621A probably benign Het
Nmnat1 G A 4: 149,469,667 Q139* probably null Het
Os9 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 10: 127,098,479 probably benign Het
Oxa1l T G 14: 54,367,664 V11G possibly damaging Het
Padi1 A G 4: 140,814,830 Y594H probably benign Het
Polr1a T A 6: 71,926,683 F327I probably benign Het
Prf1 G T 10: 61,300,193 A83S probably benign Het
Ptgs2 A G 1: 150,105,376 E470G probably benign Het
Rictor G A 15: 6,794,006 E1555K probably benign Het
Skint8 C A 4: 111,950,193 L359M probably damaging Het
Slc19a2 A G 1: 164,263,456 I278V probably benign Het
Smco1 A T 16: 32,273,856 N115I probably damaging Het
Smyd3 G A 1: 179,043,855 L320F probably damaging Het
Svil T A 18: 5,098,900 probably null Het
Syne2 A G 12: 76,097,975 D1566G probably damaging Het
Tpm2 T C 4: 43,523,296 D20G probably damaging Het
Ubap1l A G 9: 65,373,763 Y241C probably damaging Het
Usp15 A G 10: 123,124,512 probably null Het
Wdr45b A G 11: 121,331,097 probably benign Het
Zc3h14 A G 12: 98,779,155 I468V probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Ganab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Ganab APN 19 8902595 missense probably benign
IGL00434:Ganab APN 19 8907343 missense probably damaging 1.00
IGL01415:Ganab APN 19 8914694 splice site probably benign
IGL02418:Ganab APN 19 8911069 missense probably null 0.97
IGL02886:Ganab APN 19 8911027 splice site probably benign
IGL02997:Ganab APN 19 8915412 missense probably benign 0.00
IGL03108:Ganab APN 19 8912476 missense probably damaging 1.00
R0240:Ganab UTSW 19 8912813 missense possibly damaging 0.58
R0240:Ganab UTSW 19 8912813 missense possibly damaging 0.58
R0349:Ganab UTSW 19 8911652 missense probably null 0.11
R0457:Ganab UTSW 19 8907250 missense possibly damaging 0.92
R0551:Ganab UTSW 19 8907280 missense probably benign 0.35
R0645:Ganab UTSW 19 8911113 missense probably damaging 1.00
R0652:Ganab UTSW 19 8915402 critical splice acceptor site probably null
R0688:Ganab UTSW 19 8911113 missense probably damaging 1.00
R0726:Ganab UTSW 19 8911113 missense probably damaging 1.00
R1427:Ganab UTSW 19 8915666 missense probably benign 0.00
R1946:Ganab UTSW 19 8910808 missense probably damaging 1.00
R1955:Ganab UTSW 19 8911616 nonsense probably null
R2173:Ganab UTSW 19 8902260 unclassified probably benign
R2280:Ganab UTSW 19 8909468 missense probably damaging 1.00
R2281:Ganab UTSW 19 8909468 missense probably damaging 1.00
R4897:Ganab UTSW 19 8914991 missense probably benign 0.07
R5224:Ganab UTSW 19 8910591 missense probably benign 0.35
R5269:Ganab UTSW 19 8911937 missense probably damaging 1.00
R5323:Ganab UTSW 19 8908685 missense probably benign 0.00
R6469:Ganab UTSW 19 8902632 critical splice donor site probably null
R6911:Ganab UTSW 19 8907788 intron probably null
R7284:Ganab UTSW 19 8912540 missense probably damaging 1.00
R7412:Ganab UTSW 19 8912528 missense probably benign 0.01
R7413:Ganab UTSW 19 8904975 missense probably benign 0.01
R7466:Ganab UTSW 19 8914569 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGTTTACTGTCGACCGTCG -3'
(R):5'- TACTCAGGACAAAGGGACGC -3'

Sequencing Primer
(F):5'- ACTGTCGACCGTCGTCCTC -3'
(R):5'- GTATTAGCCCATCAGCAGTCG -3'
Posted On2017-02-10